Prupe.7G113000_v2.0.a1

zpr3 zpr3 (little zipper 3)

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Reverse (-)
13895611 .. 13896913
1303 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G113000.1

Sequence Viewer

Length: 234 bp
ATGGAAAGGCTGAACTCAAAGCTGTACTTGCAGAACTGCTACATAATGAAAGAGAATGAGAGGCTGAGGAAGAAAGCACAACTTCTCAACCAGGAGAATCAAGCTCTGCTTTCTGAGCTGAAGCAGAAGCTGTCCAAGACAAACTCAAAAGGCAATGCAGCAGCAAACAACAATATTCCTGACCTCAATCTCAGCTCCAGCTCCACCCAAAATCCTTCTAGTTCCAGCAACTAA

Protein Analysis

78

Amino Acids

8.65

Weight (kDa)

9.67

Isoelectric Point (pI)

35.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012505)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 140
AfaI GTAC 1 cut(s) 26
AjnI CCWGG 1 cut(s) 90
AluBI AGCT 6 cut(s) 22, 104, 118, 130, 195, 201
AluI AGCT 6 cut(s) 22, 104, 118, 130, 195, 201
AlwNI CAGNNNCTG 1 cut(s) 130
ApeKI GCWGC 2 cut(s) 158, 161
BbvCI CCTCAGC 1 cut(s) 65
BbvI GCAGC 2 cut(s) 170, 173
BciT130I CCWGG 1 cut(s) 92
BfaI CTAG 1 cut(s) 219
BisI GCNGC 2 cut(s) 159, 162
BlsI GCNGC 2 cut(s) 160, 163
Bme1390I CCNGG 1 cut(s) 92
BmrFI CCNGG 1 cut(s) 92
BpmI CTGGAG 1 cut(s) 181
Bpu10I CCTNAGC 1 cut(s) 65
Bse3DI GCAATG 1 cut(s) 160
BseBI CCWGG 1 cut(s) 92
BseMI GCAATG 1 cut(s) 160
BseMII CTCAG 3 cut(s) 56, 105, 205
BseXI GCAGC 2 cut(s) 170, 173
BspCNI CTCAG 3 cut(s) 57, 106, 204
BsrDI GCAATG 1 cut(s) 160
Bst2UI CCWGG 1 cut(s) 92
BstDEI CTNAG 3 cut(s) 65, 114, 191
BstMWI GCNNNNNNNGC 2 cut(s) 28, 115
BstNI CCWGG 1 cut(s) 92
BstSCI CCNGG 1 cut(s) 90
BstV1I GCAGC 2 cut(s) 170, 173
CaiI CAGNNNCTG 1 cut(s) 130
Csp6I GTAC 1 cut(s) 25
CviJI RGCY 8 cut(s) 10, 22, 64, 104, 118, 130, 195, 201
CviKI_1 RGCY 8 cut(s) 10, 22, 64, 104, 118, 130, 195, 201
CviQI GTAC 1 cut(s) 25
DdeI CTNAG 3 cut(s) 65, 114, 191
Eco57I CTGAAG 1 cut(s) 140
EcoRII CCWGG 1 cut(s) 90
FaiI YATR 1 cut(s) 44
FalI AAGNNNNNCTT 6 cut(s) 11, 43, 66, 98, 93, 125
Fnu4HI GCNGC 2 cut(s) 159, 162
Fsp4HI GCNGC 2 cut(s) 159, 162
FspBI CTAG 1 cut(s) 219
GluI GCNGC 2 cut(s) 159, 162
GsuI CTGGAG 1 cut(s) 181
HinfI GANTC 1 cut(s) 97
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 1 cut(s) 179
HpyAV CCTTC 1 cut(s) 225
HpyCH4V TGCA 2 cut(s) 31, 158
HpyF10VI GCNNNNNNNGC 2 cut(s) 28, 115
HpyF3I CTNAG 3 cut(s) 65, 114, 191
LmnI GCTCC 2 cut(s) 200, 206
LpnPI CCDG 4 cut(s) 77, 104, 192, 211
Lsp1109I GCAGC 2 cut(s) 170, 173
MaeI CTAG 1 cut(s) 219
MboII GAAGA 1 cut(s) 82
MnlI CCTC 3 cut(s) 54, 60, 194
MspR9I CCNGG 1 cut(s) 92
MvaI CCWGG 1 cut(s) 92
MwoI GCNNNNNNNGC 2 cut(s) 28, 115
PfeI GAWTC 1 cut(s) 97
PkrI GCNGC 2 cut(s) 160, 163
Psp6I CCWGG 1 cut(s) 90
PspGI CCWGG 1 cut(s) 90
PstNI CAGNNNCTG 1 cut(s) 130
RsaI GTAC 1 cut(s) 26
RsaNI GTAC 1 cut(s) 25
SatI GCNGC 2 cut(s) 159, 162
ScrFI CCNGG 1 cut(s) 92
SetI ASST 7 cut(s) 24, 106, 120, 132, 186, 197, 203
SgeI CNNG 7 cut(s) 40, 103, 104, 113, 148, 191, 210
SspI AATATT 1 cut(s) 175
SspMI CTAG 1 cut(s) 219
StyD4I CCNGG 1 cut(s) 90
TatI WGTACW 1 cut(s) 24
TfiI GAWTC 1 cut(s) 97
TseI GCWGC 2 cut(s) 158, 161
TspDTI ATGAA 1 cut(s) 62
XspI CTAG 1 cut(s) 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.