Prupe.2G079600_v2.0.a1

zpr3 zpr3 (little zipper 3)

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Reverse (-)
12166631 .. 12167162
532 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G079600.1

Sequence Viewer

Length: 222 bp
ATGGAGAAGCTGAACTCGCAGATACATTTGCAAAACTGTTATATAATCCGACAAAATGAAATGCTAAGGAAGAAAGCTCAAGTGCTCAACCAGGAGAATCAGGCTTTGTTATCTGAGCTGAAGCAAAAACTCTCCAAGGCCAACACCAAGCTAAGAGGTAGTCCTGACATTGATGTTAGTTCTGCTTCCTCCTCAGATTCCATCAGTTCCAGTAAACCGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.17

Weight (kDa)

9.52

Isoelectric Point (pI)

44.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012505)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 140
AjnI CCWGG 1 cut(s) 90
AluBI AGCT 4 cut(s) 10, 77, 118, 151
AluI AGCT 4 cut(s) 10, 77, 118, 151
Alw21I GWGCWC 1 cut(s) 87
AoxI GGCC 1 cut(s) 138
Bbv12I GWGCWC 1 cut(s) 87
BccI CCATC 1 cut(s) 209
BciT130I CCWGG 1 cut(s) 92
Bme1390I CCNGG 1 cut(s) 92
BmrFI CCNGG 1 cut(s) 92
Bpu10I CCTNAGC 1 cut(s) 65
BpuEI CTTGAG 1 cut(s) 63
BsaJI CCNNGG 1 cut(s) 135
Bse1I ACTGG 1 cut(s) 210
BseBI CCWGG 1 cut(s) 92
BseDI CCNNGG 1 cut(s) 135
BseMII CTCAG 2 cut(s) 105, 207
BseNI ACTGG 1 cut(s) 210
BseRI GAGGAG 1 cut(s) 181
BshFI GGCC 1 cut(s) 140
BsiHKAI GWGCWC 1 cut(s) 87
BsnI GGCC 1 cut(s) 140
Bsp1286I GDGCHC 1 cut(s) 87
BspANI GGCC 1 cut(s) 140
BspCNI CTCAG 2 cut(s) 106, 206
BsrI ACTGG 1 cut(s) 210
BssECI CCNNGG 1 cut(s) 135
BssT1I CCWWGG 1 cut(s) 135
Bst2UI CCWGG 1 cut(s) 92
Bst4CI ACNGT 2 cut(s) 38, 219
BstDEI CTNAG 4 cut(s) 65, 114, 152, 193
BstMWI GCNNNNNNNGC 1 cut(s) 16
BstNI CCWGG 1 cut(s) 92
BstSCI CCNGG 1 cut(s) 90
BsuRI GGCC 1 cut(s) 140
CviJI RGCY 6 cut(s) 10, 77, 104, 118, 140, 151
CviKI_1 RGCY 6 cut(s) 10, 77, 104, 118, 140, 151
DdeI CTNAG 4 cut(s) 65, 114, 152, 193
Eco130I CCWWGG 1 cut(s) 135
Eco57I CTGAAG 1 cut(s) 140
EcoRII CCWGG 1 cut(s) 90
EcoT14I CCWWGG 1 cut(s) 135
ErhI CCWWGG 1 cut(s) 135
FaiI YATR 2 cut(s) 42, 44
HaeIII GGCC 1 cut(s) 140
HinfI GANTC 2 cut(s) 97, 197
Hpy166II GTNNAC 1 cut(s) 215
Hpy188I TCNGA 3 cut(s) 50, 115, 196
Hpy188III TCNNGA 1 cut(s) 164
Hpy8I GTNNAC 1 cut(s) 215
HpyCH4III ACNGT 2 cut(s) 38, 219
HpyCH4V TGCA 1 cut(s) 31
HpyF10VI GCNNNNNNNGC 1 cut(s) 16
HpyF3I CTNAG 4 cut(s) 65, 114, 152, 193
LpnPI CCDG 4 cut(s) 77, 86, 104, 177
MboII GAAGA 1 cut(s) 82
MhlI GDGCHC 1 cut(s) 87
MmeI TCCRAC 1 cut(s) 73
MnlI CCTC 3 cut(s) 149, 199, 202
MspR9I CCNGG 1 cut(s) 92
MvaI CCWGG 1 cut(s) 92
MwoI GCNNNNNNNGC 1 cut(s) 16
PfeI GAWTC 2 cut(s) 97, 197
Psp6I CCWGG 1 cut(s) 90
PspGI CCWGG 1 cut(s) 90
ScrFI CCNGG 1 cut(s) 92
SduI GDGCHC 1 cut(s) 87
SetI ASST 5 cut(s) 12, 79, 120, 153, 160
SgeI CNNG 8 cut(s) 28, 92, 103, 104, 113, 148, 160, 176
SmlI CTYRAG 1 cut(s) 78
SmoI CTYRAG 1 cut(s) 78
StyD4I CCNGG 1 cut(s) 90
StyI CCWWGG 1 cut(s) 135
TaaI ACNGT 2 cut(s) 38, 219
TfiI GAWTC 2 cut(s) 97, 197
TspDTI ATGAA 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.