AT3G62640

Domain of unknown function (DUF3511)

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Reverse (-)
23166219 .. 23166979
761 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G62640.1

Sequence Viewer

Length: 333 bp
ATGGACGGGTTCGGGTCGCATCCAAGAACACTCGCCGTTGATCAATGGATGGATATAGTTAATGGTAAAGGTTACGGCGTTGGTGGAACAACCCAAGTCTACTCAACTCGACCCGACTCACCAAAGTTTCAACCGTCTATTCCGCCTCCACCAGGGTCTACATCGAAGACACGTACAACTGCTACTCCTTGGAGATTAATCGATGCGGAAACGAAGAGAAAAAAAAGAATCGCTACGTACAAGACTTACGCTTTGGAAGGAAAAGTCAAATCCACGGTCAAGAAAGGGTTTCATTGGATCAAAGACAGGTATTCTCATATTATACACGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

12.32

Weight (kDa)

10.14

Isoelectric Point (pI)

24.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF3511 PF12023 68 - 110 6.9e-24 Domain of unknown function (DUF3511)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018324)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G47480 AT3G62640
fragaria_vesca FvH4_4g19290
prunus_persica Prupe.1G125500_v2.0.a1
rosa_chinensis RchiOBHm_Chr4g0424301
rosa_laevigata RLG00000007488
rosa_roxburghii Rroxscaffold_5G00366260
rosa_samantha Rh4CG268700 Rh4DG252300
rosa_wichuraiana Rw4G021780

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 99, 158
AciI CCGC 2 cut(s) 143, 206
AclWI GGATC 1 cut(s) 305
AfaI GTAC 2 cut(s) 175, 239
AfiI CCNNNNNNNGG 1 cut(s) 152
AflIII ACRYGT 1 cut(s) 170
AgsI TTSAA 1 cut(s) 131
AjnI CCWGG 1 cut(s) 151
AlwI GGATC 1 cut(s) 305
ArsI GACNNNNNNTTYG 4 cut(s) 235, 261, 267, 293
AseI ATTAAT 1 cut(s) 197
AsuHPI GGTGA 1 cut(s) 111
BbsI GAAGAC 1 cut(s) 173
BccI CCATC 1 cut(s) 43
BceAI ACGGC 2 cut(s) 20, 91
BciT130I CCWGG 1 cut(s) 153
BclI TGATCA 1 cut(s) 40
Bme1390I CCNGG 1 cut(s) 153
BmrFI CCNGG 1 cut(s) 153
BmsI GCATC 2 cut(s) 28, 193
BpiI GAAGAC 1 cut(s) 173
Bsa29I ATCGAT 1 cut(s) 201
BsaAI YACGTR 2 cut(s) 173, 237
BsaJI CCNNGG 3 cut(s) 152, 188, 273
BsaXI ACNNNNNCTCC 2 cut(s) 169, 199
Bsc4I CCNNNNNNNGG 1 cut(s) 152
BseBI CCWGG 1 cut(s) 153
BseCI ATCGAT 1 cut(s) 201
BseDI CCNNGG 3 cut(s) 152, 188, 273
BseGI GGATG 2 cut(s) 19, 54
BseLI CCNNNNNNNGG 1 cut(s) 152
BshVI ATCGAT 1 cut(s) 201
BslI CCNNNNNNNGG 1 cut(s) 152
Bsp143I GATC 2 cut(s) 40, 297
BspACI CCGC 2 cut(s) 143, 206
BspDI ATCGAT 1 cut(s) 201
BspPI GGATC 1 cut(s) 305
BssECI CCNNGG 3 cut(s) 152, 188, 273
BssMI GATC 2 cut(s) 40, 297
BssT1I CCWWGG 1 cut(s) 188
Bst2UI CCWGG 1 cut(s) 153
Bst4CI ACNGT 2 cut(s) 135, 277
Bst6I CTCTTC 1 cut(s) 209
BstBAI YACGTR 2 cut(s) 173, 237
BstDSI CCRYGG 1 cut(s) 273
BstENI CCTNNNNNAGG 1 cut(s) 150
BstF5I GGATG 2 cut(s) 19, 54
BstKTI GATC 2 cut(s) 43, 300
BstMBI GATC 2 cut(s) 40, 297
BstNI CCWGG 1 cut(s) 153
BstSCI CCNGG 1 cut(s) 151
BstSNI TACGTA 1 cut(s) 237
BstV2I GAAGAC 1 cut(s) 173
Bsu15I ATCGAT 1 cut(s) 201
BsuTUI ATCGAT 1 cut(s) 201
BtgI CCRYGG 1 cut(s) 273
BtsCI GGATG 2 cut(s) 19, 54
ClaI ATCGAT 1 cut(s) 201
Csp6I GTAC 2 cut(s) 174, 238
CviQI GTAC 2 cut(s) 174, 238
DpnI GATC 2 cut(s) 42, 299
DpnII GATC 2 cut(s) 40, 297
Eam1104I CTCTTC 1 cut(s) 209
EarI CTCTTC 1 cut(s) 209
EciI GGCGGA 1 cut(s) 132
Eco105I TACGTA 1 cut(s) 237
Eco130I CCWWGG 1 cut(s) 188
EcoNI CCTNNNNNAGG 1 cut(s) 150
EcoRII CCWGG 1 cut(s) 151
EcoT14I CCWWGG 1 cut(s) 188
ErhI CCWWGG 1 cut(s) 188
FaiI YATR 3 cut(s) 56, 318, 323
FbaI TGATCA 1 cut(s) 40
FblI GTMKAC 2 cut(s) 99, 158
FokI GGATG 2 cut(s) 6, 61
HinfI GANTC 2 cut(s) 116, 228
HphI GGTGA 1 cut(s) 111
Hpy166II GTNNAC 2 cut(s) 100, 159
Hpy188III TCNNGA 1 cut(s) 280
Hpy8I GTNNAC 2 cut(s) 100, 159
HpyAV CCTTC 1 cut(s) 251
HpyCH4III ACNGT 2 cut(s) 135, 277
HpyCH4IV ACGT 2 cut(s) 172, 236
HpySE526I ACGT 2 cut(s) 172, 236
Ksp22I TGATCA 1 cut(s) 40
Kzo9I GATC 2 cut(s) 40, 297
LpnPI CCDG 3 cut(s) 138, 165, 292
LweI GCATC 2 cut(s) 28, 193
MaeII ACGT 2 cut(s) 172, 236
MaeIII GTNAC 1 cut(s) 71
MalI GATC 2 cut(s) 42, 299
MboI GATC 2 cut(s) 40, 297
MboII GAAGA 2 cut(s) 178, 226
MlyI GAGTC 1 cut(s) 110
MnlI CCTC 1 cut(s) 156
MseI TTAA 2 cut(s) 60, 197
MspR9I CCNGG 1 cut(s) 153
MvaI CCWGG 1 cut(s) 153
NdeII GATC 2 cut(s) 40, 297
PfeI GAWTC 1 cut(s) 228
PleI GAGTC 1 cut(s) 110
PpsI GAGTC 1 cut(s) 110
Ppu21I YACGTR 2 cut(s) 173, 237
PshBI ATTAAT 1 cut(s) 197
Psp6I CCWGG 1 cut(s) 151
PspGI CCWGG 1 cut(s) 151
RsaI GTAC 2 cut(s) 175, 239
RsaNI GTAC 2 cut(s) 174, 238
SaqAI TTAA 2 cut(s) 60, 197
Sau3AI GATC 2 cut(s) 40, 297
SchI GAGTC 1 cut(s) 110
ScrFI CCNGG 1 cut(s) 153
SetI ASST 4 cut(s) 73, 175, 239, 311
SfaNI GCATC 2 cut(s) 28, 193
SnaBI TACGTA 1 cut(s) 237
SsiI CCGC 2 cut(s) 143, 206
StyD4I CCNGG 1 cut(s) 151
StyI CCWWGG 1 cut(s) 188
TaaI ACNGT 2 cut(s) 135, 277
TaiI ACGT 2 cut(s) 175, 239
TaqI TCGA 3 cut(s) 109, 164, 201
TfiI GAWTC 1 cut(s) 228
Tru1I TTAA 2 cut(s) 60, 197
Tru9I TTAA 2 cut(s) 60, 197
TspDTI ATGAA 1 cut(s) 281
VspI ATTAAT 1 cut(s) 197
XagI CCTNNNNNAGG 1 cut(s) 150
XmiI GTMKAC 2 cut(s) 99, 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.