RchiOBHm_Chr4g0424301

Domain of unknown function (DUF3511)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
49876826 .. 49877293
468 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ39358

Sequence Viewer

Length: 258 bp
ATGAGAGAGATGGACGATATCTCGTCAGCATACGGATCATCACCTTATGGTGATGTTAGCCACCAAAATGAGGCTTATGCGTGGGAAAGCAATAAAGAGTATTCACGCAAAACGTCGTCTTTAAGCTTCAAAAATTCAGAGATCAAGAGACAACGTCGAGTGGCCAAATACAAGTCATATTGTGTCCAAACCAAATTGAAGAGTGCCATAAAGAATGGGGTTCGTTGGTTTAGAAACAAGTATTCTTCGGTCGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.94

Weight (kDa)

9.85

Isoelectric Point (pI)

51.26

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF3511 PF12023 43 - 85 3.5e-15 Domain of unknown function (DUF3511)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018324)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G47480 AT3G62640
fragaria_vesca FvH4_4g19290
prunus_persica Prupe.1G125500_v2.0.a1
rosa_chinensis RchiOBHm_Chr4g0424301
rosa_laevigata RLG00000007488
rosa_roxburghii Rroxscaffold_5G00366260
rosa_samantha Rh4CG268700 Rh4DG252300
rosa_wichuraiana Rw4G021780

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 43
AcoI YGGCCR 1 cut(s) 162
AcsI RAATTY 1 cut(s) 133
AfiI CCNNNNNNNGG 1 cut(s) 70
AgsI TTSAA 2 cut(s) 130, 199
AluBI AGCT 1 cut(s) 126
AluI AGCT 1 cut(s) 126
Alw26I GTCTC 1 cut(s) 142
AlwI GGATC 1 cut(s) 43
AoxI GGCC 1 cut(s) 162
ApoI RAATTY 1 cut(s) 133
AsuHPI GGTGA 2 cut(s) 33, 62
BalI TGGCCA 1 cut(s) 164
BccI CCATC 1 cut(s) 4
BcoDI GTCTC 1 cut(s) 142
Bsc4I CCNNNNNNNGG 1 cut(s) 70
BseLI CCNNNNNNNGG 1 cut(s) 70
Bsh1285I CGRYCG 1 cut(s) 252
BshFI GGCC 1 cut(s) 164
BsiEI CGRYCG 1 cut(s) 252
BslI CCNNNNNNNGG 1 cut(s) 70
BsmAI GTCTC 1 cut(s) 142
BsnI GGCC 1 cut(s) 164
Bsp143I GATC 2 cut(s) 35, 141
BspANI GGCC 1 cut(s) 164
BspPI GGATC 1 cut(s) 43
BssMI GATC 2 cut(s) 35, 141
Bst6I CTCTTC 1 cut(s) 194
BstKTI GATC 2 cut(s) 38, 144
BstMAI GTCTC 1 cut(s) 142
BstMBI GATC 2 cut(s) 35, 141
BstMCI CGRYCG 1 cut(s) 252
BsuRI GGCC 1 cut(s) 164
CviJI RGCY 4 cut(s) 60, 74, 126, 164
CviKI_1 RGCY 4 cut(s) 60, 74, 126, 164
DpnI GATC 2 cut(s) 37, 143
DpnII GATC 2 cut(s) 35, 141
EaeI YGGCCR 1 cut(s) 162
Eam1104I CTCTTC 1 cut(s) 194
EarI CTCTTC 1 cut(s) 194
Eco32I GATATC 1 cut(s) 19
EcoRV GATATC 1 cut(s) 19
FaiI YATR 5 cut(s) 31, 48, 78, 178, 209
HaeIII GGCC 1 cut(s) 164
HindIII AAGCTT 1 cut(s) 124
HphI GGTGA 2 cut(s) 33, 62
Hpy188I TCNGA 1 cut(s) 139
Hpy188III TCNNGA 1 cut(s) 145
Hpy99I CGWCG 2 cut(s) 118, 159
HpyCH4IV ACGT 2 cut(s) 113, 154
HpySE526I ACGT 2 cut(s) 113, 154
Kzo9I GATC 2 cut(s) 35, 141
MaeII ACGT 2 cut(s) 113, 154
MalI GATC 2 cut(s) 37, 143
MboI GATC 2 cut(s) 35, 141
MboII GAAGA 2 cut(s) 211, 237
MlsI TGGCCA 1 cut(s) 164
MluCI AATT 2 cut(s) 133, 194
MluNI TGGCCA 1 cut(s) 164
MnlI CCTC 1 cut(s) 64
Mox20I TGGCCA 1 cut(s) 164
MscI TGGCCA 1 cut(s) 164
MseI TTAA 2 cut(s) 122, 256
MslI CAYNNNNRTG 1 cut(s) 66
Msp20I TGGCCA 1 cut(s) 164
NdeII GATC 2 cut(s) 35, 141
PflFI GACNNNGTC 1 cut(s) 153
PsyI GACNNNGTC 1 cut(s) 153
RseI CAYNNNNRTG 1 cut(s) 66
SaqAI TTAA 2 cut(s) 122, 256
Sau3AI GATC 2 cut(s) 35, 141
SetI ASST 4 cut(s) 46, 116, 128, 157
SgeI CNNG 7 cut(s) 34, 93, 117, 157, 170, 184, 250
SmiMI CAYNNNNRTG 1 cut(s) 66
Sse9I AATT 2 cut(s) 133, 194
TaiI ACGT 2 cut(s) 116, 157
TaqI TCGA 1 cut(s) 157
TaqII GACCGA 1 cut(s) 238
TasI AATT 2 cut(s) 133, 194
Tru1I TTAA 2 cut(s) 122, 256
Tru9I TTAA 2 cut(s) 122, 256
TspGWI ACGGA 1 cut(s) 48
Tth111I GACNNNGTC 1 cut(s) 153
XapI RAATTY 1 cut(s) 133
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.