Prupe.1G125500_v2.0.a1

Domain of unknown function (DUF3511)

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Reverse (-)
9894031 .. 9894652
622 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G125500.1

Sequence Viewer

Length: 273 bp
ATGAGAGAGATGGACGAGATGCGGTCAACTTATGTGTCACCCTATGGGCCTAGTGGTGACCGGAGCTTTGACAATGAGGGTTATGCGTGGGAGAGTAAGAAAAATTCATCACATAAATCTTCGTCAATCTACAGTTTCAGCCAATCAGAGCTTAAGAGACAACGTCGAGTAGCCAAATACAAGTCCTATGTCGTTGAAGCCAAATTTAAATCCGCTTTAAAGAATGGGGTACGTTGGTTCAAGAACAAGTATTTTGCACTTGTATATGCGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

10.6

Weight (kDa)

9.86

Isoelectric Point (pI)

62.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018324)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G47480 AT3G62640
fragaria_vesca FvH4_4g19290
prunus_persica Prupe.1G125500_v2.0.a1
rosa_chinensis RchiOBHm_Chr4g0424301
rosa_laevigata RLG00000007488
rosa_roxburghii Rroxscaffold_5G00366260
rosa_samantha Rh4CG268700 Rh4DG252300
rosa_wichuraiana Rw4G021780

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 22, 213
AcsI RAATTY 2 cut(s) 103, 203
AfaI GTAC 1 cut(s) 231
AflII CTTAAG 1 cut(s) 152
AgsI TTSAA 2 cut(s) 197, 241
AluBI AGCT 2 cut(s) 66, 151
AluI AGCT 2 cut(s) 66, 151
Alw26I GTCTC 1 cut(s) 151
AoxI GGCC 1 cut(s) 47
ApoI RAATTY 2 cut(s) 103, 203
ArsI GACNNNNNNTTYG 2 cut(s) 50, 82
AspS9I GGNCC 1 cut(s) 47
AsuHPI GGTGA 2 cut(s) 30, 68
BaeI ACNNNNGTAYC 2 cut(s) 221, 254
BccI CCATC 1 cut(s) 4
BcoDI GTCTC 1 cut(s) 151
BfaI CTAG 1 cut(s) 51
BfmI CTRYAG 1 cut(s) 130
BfrI CTTAAG 1 cut(s) 152
BmgT120I GGNCC 1 cut(s) 47
BmsI GCATC 1 cut(s) 9
BsaWI WCCGGW 1 cut(s) 60
BshFI GGCC 1 cut(s) 49
BsiSI CCGG 1 cut(s) 61
BsmAI GTCTC 1 cut(s) 151
BsnI GGCC 1 cut(s) 49
BspACI CCGC 2 cut(s) 22, 213
BspANI GGCC 1 cut(s) 49
BspTI CTTAAG 1 cut(s) 152
Bst4CI ACNGT 1 cut(s) 134
BstAFI CTTAAG 1 cut(s) 152
BstEII GGTNACC 1 cut(s) 56
BstMAI GTCTC 1 cut(s) 151
BstPI GGTNACC 1 cut(s) 56
BstSFI CTRYAG 1 cut(s) 130
BsuRI GGCC 1 cut(s) 49
Cfr13I GGNCC 1 cut(s) 47
Csp6I GTAC 1 cut(s) 230
CviJI RGCY 6 cut(s) 49, 66, 141, 151, 173, 200
CviKI_1 RGCY 6 cut(s) 49, 66, 141, 151, 173, 200
CviQI GTAC 1 cut(s) 230
DraI TTTAAA 2 cut(s) 208, 219
Eco91I GGTNACC 1 cut(s) 56
EcoO65I GGTNACC 1 cut(s) 56
FaiI YATR 7 cut(s) 33, 45, 84, 114, 189, 265, 267
FspBI CTAG 1 cut(s) 51
HaeIII GGCC 1 cut(s) 49
HapII CCGG 1 cut(s) 61
HincII GTYRAC 1 cut(s) 27
HindII GTYRAC 1 cut(s) 27
HpaII CCGG 1 cut(s) 61
HphI GGTGA 2 cut(s) 30, 68
Hpy166II GTNNAC 1 cut(s) 27
Hpy188I TCNGA 1 cut(s) 148
Hpy188III TCNNGA 1 cut(s) 241
Hpy8I GTNNAC 1 cut(s) 27
Hpy99I CGWCG 1 cut(s) 168
HpyCH4III ACNGT 1 cut(s) 134
HpyCH4IV ACGT 2 cut(s) 163, 232
HpyCH4V TGCA 1 cut(s) 257
HpySE526I ACGT 2 cut(s) 163, 232
LmnI GCTCC 1 cut(s) 63
LpnPI CCDG 1 cut(s) 74
LweI GCATC 1 cut(s) 9
MaeI CTAG 1 cut(s) 51
MaeII ACGT 2 cut(s) 163, 232
MaeIII GTNAC 2 cut(s) 36, 56
MboII GAAGA 1 cut(s) 111
MluCI AATT 2 cut(s) 103, 203
MnlI CCTC 1 cut(s) 70
MseI TTAA 3 cut(s) 153, 207, 218
MspCI CTTAAG 1 cut(s) 152
MspI CCGG 1 cut(s) 61
NmuCI GTSAC 2 cut(s) 36, 56
PflFI GACNNNGTC 1 cut(s) 162
PspEI GGTNACC 1 cut(s) 56
PspPI GGNCC 1 cut(s) 47
PsyI GACNNNGTC 1 cut(s) 162
RsaI GTAC 1 cut(s) 231
RsaNI GTAC 1 cut(s) 230
SaqAI TTAA 3 cut(s) 153, 207, 218
Sau96I GGNCC 1 cut(s) 47
SetI ASST 4 cut(s) 68, 153, 166, 235
SfaNI GCATC 1 cut(s) 9
SfcI CTRYAG 1 cut(s) 130
SgeI CNNG 8 cut(s) 28, 63, 73, 99, 179, 193, 253, 259
SmiI ATTTAAAT 1 cut(s) 208
SmlI CTYRAG 1 cut(s) 152
SmoI CTYRAG 1 cut(s) 152
Sse9I AATT 2 cut(s) 103, 203
SsiI CCGC 2 cut(s) 22, 213
SspMI CTAG 1 cut(s) 51
SwaI ATTTAAAT 1 cut(s) 208
TaaI ACNGT 1 cut(s) 134
TaiI ACGT 2 cut(s) 166, 235
TaqI TCGA 1 cut(s) 166
TasI AATT 2 cut(s) 103, 203
Tru1I TTAA 3 cut(s) 153, 207, 218
Tru9I TTAA 3 cut(s) 153, 207, 218
TseFI GTSAC 2 cut(s) 36, 56
Tsp45I GTSAC 2 cut(s) 36, 56
TspDTI ATGAA 1 cut(s) 96
Tth111I GACNNNGTC 1 cut(s) 162
Vha464I CTTAAG 1 cut(s) 152
XapI RAATTY 2 cut(s) 103, 203
XspI CTAG 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.