Basic Information

Type: gene

Biological Identity

Species

fragaria_vesca

Chromosome

Fvb4

Orthogroup ID

OG0018324

Physical Location & Seq

Genomic Coordinates Forward (+)

22988702 .. 22990844

Gene Structure 2143 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

FvH4_4g19290.t1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 261 bp

ATGATGAGAGAGATGAACAATATGCCGTCAACATACGGATCATCACCTTATGGTGATGGCAACCACCACAATGAGACTTATGAGTGGGAGAGCAATAAGAAGTATTCGCGCAAATCATCGTCTTTTAGCTTCAAAAGTTCAGAAGCCAAGAGAAAACGTCGAGTGGCAAAATACAAGGCATATTGCCTTAAAGCCAAATTGAAGTCTAGCATGAAGAATGGGATTTGTTGGTTCAAAAACAAGTATTATTCGCTTGTTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF3511

Protein Analysis

87

Amino Acids

10.19

Weight (kDa)

9.93

Isoelectric Point (pI)

53.2

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
DUF3511	PF12023	45 - 86	4.1e-15	Domain of unknown function (DUF3511)

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018324)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G47480 AT3G62640
fragaria_vesca	FvH4_4g19290
prunus_persica	Prupe.1G125500_v2.0.a1
rosa_chinensis	RchiOBHm_Chr4g0424301
rosa_laevigata	RLG00000007488
rosa_roxburghii	Rroxscaffold_5G00366260
rosa_samantha	Rh4CG268700 Rh4DG252300
rosa_wichuraiana	Rw4G021780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	109
AclWI	GGATC	1 cut(s)	46
AgsI	TTSAA	3 cut(s)	133, 202, 235
AluBI	AGCT	1 cut(s)	129
AluI	AGCT	1 cut(s)	129
Alw26I	GTCTC	1 cut(s)	68
AlwI	GGATC	1 cut(s)	46
AspLEI	GCGC	1 cut(s)	111
AsuHPI	GGTGA	2 cut(s)	36, 65
BccI	CCATC	1 cut(s)	50
BceAI	ACGGC	1 cut(s)	10
BcoDI	GTCTC	1 cut(s)	68
BfaI	CTAG	1 cut(s)	207
Bsh1236I	CGCG	1 cut(s)	109
BsmAI	GTCTC	1 cut(s)	68
Bsp143I	GATC	1 cut(s)	38
BspFNI	CGCG	1 cut(s)	109
BspPI	GGATC	1 cut(s)	46
BssMI	GATC	1 cut(s)	38
BstFNI	CGCG	1 cut(s)	109
BstHHI	GCGC	1 cut(s)	111
BstKTI	GATC	1 cut(s)	41
BstMAI	GTCTC	1 cut(s)	68
BstMBI	GATC	1 cut(s)	38
BstUI	CGCG	1 cut(s)	109
CfoI	GCGC	1 cut(s)	111
CviAII	CATG	1 cut(s)	211
CviJI	RGCY	3 cut(s)	129, 146, 194
CviKI_1	RGCY	3 cut(s)	129, 146, 194
DpnI	GATC	1 cut(s)	40
DpnII	GATC	1 cut(s)	38
FaeI	CATG	1 cut(s)	214
FaiI	YATR	6 cut(s)	23, 34, 51, 81, 181, 212
FatI	CATG	1 cut(s)	210
FspBI	CTAG	1 cut(s)	207
GlaI	GCGC	1 cut(s)	110
HhaI	GCGC	1 cut(s)	111
Hin1II	CATG	1 cut(s)	214
Hin6I	GCGC	1 cut(s)	109
HinP1I	GCGC	1 cut(s)	109
HincII	GTYRAC	1 cut(s)	30
HindII	GTYRAC	1 cut(s)	30
HphI	GGTGA	2 cut(s)	36, 65
Hpy166II	GTNNAC	1 cut(s)	30
Hpy188I	TCNGA	1 cut(s)	142
Hpy8I	GTNNAC	1 cut(s)	30
Hpy99I	CGWCG	1 cut(s)	162
HpyCH4IV	ACGT	1 cut(s)	157
HpySE526I	ACGT	1 cut(s)	157
Hsp92II	CATG	1 cut(s)	214
HspAI	GCGC	1 cut(s)	109
Kzo9I	GATC	1 cut(s)	38
MaeI	CTAG	1 cut(s)	207
MaeII	ACGT	1 cut(s)	157
MalI	GATC	1 cut(s)	40
MboI	GATC	1 cut(s)	38
MboII	GAAGA	1 cut(s)	226
MluCI	AATT	1 cut(s)	197
MseI	TTAA	2 cut(s)	189, 259
MslI	CAYNNNNRTG	1 cut(s)	69
MvnI	CGCG	1 cut(s)	109
NdeII	GATC	1 cut(s)	38
NlaIII	CATG	1 cut(s)	214
RseI	CAYNNNNRTG	1 cut(s)	69
SaqAI	TTAA	2 cut(s)	189, 259
Sau3AI	GATC	1 cut(s)	38
SetI	ASST	3 cut(s)	49, 131, 160
SgeI	CNNG	7 cut(s)	120, 160, 173, 187, 219, 223, 253
SmiMI	CAYNNNNRTG	1 cut(s)	69
Sse9I	AATT	1 cut(s)	197
SspMI	CTAG	1 cut(s)	207
TaiI	ACGT	1 cut(s)	160
TaqI	TCGA	1 cut(s)	160
TasI	AATT	1 cut(s)	197
Tru1I	TTAA	2 cut(s)	189, 259
Tru9I	TTAA	2 cut(s)	189, 259
TspDTI	ATGAA	2 cut(s)	29, 227
TspGWI	ACGGA	1 cut(s)	51
XspI	CTAG	1 cut(s)	207

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.