Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr4D

Orthogroup ID

OG0018324

Physical Location & Seq

Genomic Coordinates Forward (+)

46740425 .. 46743403

Gene Structure 2979 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh4DG252300.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 261 bp

ATGATGAGAGAGATGGACGATATCTCGTCAGCATACGGATCATCACCTTATGGTGATGTTAGCCACCAAAATGAGGCTTATGCGTGGGAAAGCAATAAAGAGTATTCACGCAAAACGTCGTCTTTAAGCTTCAAAAATTCAGAGATCAAGAGACAACGTCGAGTGGCCAAATACAAGTCATATTGTGTCCAAACCAAATTGAAGAGTGCCATAAAGAATGGGGTTCGTTGGCTTAGAAACAAGTATTCTTCGGTTGTTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF3511

Protein Analysis

86

Amino Acids

10.04

Weight (kDa)

9.85

Isoelectric Point (pI)

54.12

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
DUF3511	PF12023	44 - 86	3.7e-15	Domain of unknown function (DUF3511)

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018324)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G47480 AT3G62640
fragaria_vesca	FvH4_4g19290
prunus_persica	Prupe.1G125500_v2.0.a1
rosa_chinensis	RchiOBHm_Chr4g0424301
rosa_laevigata	RLG00000007488
rosa_roxburghii	Rroxscaffold_5G00366260
rosa_samantha	Rh4CG268700 Rh4DG252300
rosa_wichuraiana	Rw4G021780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	46
AcoI	YGGCCR	1 cut(s)	165
AcsI	RAATTY	1 cut(s)	136
AfiI	CCNNNNNNNGG	1 cut(s)	73
AgsI	TTSAA	2 cut(s)	133, 202
AluBI	AGCT	1 cut(s)	129
AluI	AGCT	1 cut(s)	129
Alw26I	GTCTC	1 cut(s)	145
AlwI	GGATC	1 cut(s)	46
AoxI	GGCC	1 cut(s)	165
ApoI	RAATTY	1 cut(s)	136
AsuHPI	GGTGA	2 cut(s)	36, 65
BalI	TGGCCA	1 cut(s)	167
BccI	CCATC	1 cut(s)	7
BcoDI	GTCTC	1 cut(s)	145
Bsc4I	CCNNNNNNNGG	1 cut(s)	73
BseLI	CCNNNNNNNGG	1 cut(s)	73
BshFI	GGCC	1 cut(s)	167
BslI	CCNNNNNNNGG	1 cut(s)	73
BsmAI	GTCTC	1 cut(s)	145
BsnI	GGCC	1 cut(s)	167
Bsp143I	GATC	2 cut(s)	38, 144
BspANI	GGCC	1 cut(s)	167
BspPI	GGATC	1 cut(s)	46
BssMI	GATC	2 cut(s)	38, 144
Bst6I	CTCTTC	1 cut(s)	197
BstDEI	CTNAG	1 cut(s)	233
BstKTI	GATC	2 cut(s)	41, 147
BstMAI	GTCTC	1 cut(s)	145
BstMBI	GATC	2 cut(s)	38, 144
BsuRI	GGCC	1 cut(s)	167
CviJI	RGCY	5 cut(s)	63, 77, 129, 167, 232
CviKI_1	RGCY	5 cut(s)	63, 77, 129, 167, 232
DdeI	CTNAG	1 cut(s)	233
DpnI	GATC	2 cut(s)	40, 146
DpnII	GATC	2 cut(s)	38, 144
EaeI	YGGCCR	1 cut(s)	165
Eam1104I	CTCTTC	1 cut(s)	197
EarI	CTCTTC	1 cut(s)	197
Eco32I	GATATC	1 cut(s)	22
EcoRV	GATATC	1 cut(s)	22
FaiI	YATR	5 cut(s)	34, 51, 81, 181, 212
HaeIII	GGCC	1 cut(s)	167
HindIII	AAGCTT	1 cut(s)	127
HphI	GGTGA	2 cut(s)	36, 65
Hpy188I	TCNGA	1 cut(s)	142
Hpy188III	TCNNGA	1 cut(s)	148
Hpy99I	CGWCG	2 cut(s)	121, 162
HpyCH4IV	ACGT	2 cut(s)	116, 157
HpyF3I	CTNAG	1 cut(s)	233
HpySE526I	ACGT	2 cut(s)	116, 157
Kzo9I	GATC	2 cut(s)	38, 144
MaeII	ACGT	2 cut(s)	116, 157
MalI	GATC	2 cut(s)	40, 146
MboI	GATC	2 cut(s)	38, 144
MboII	GAAGA	2 cut(s)	214, 240
MlsI	TGGCCA	1 cut(s)	167
MluCI	AATT	2 cut(s)	136, 197
MluNI	TGGCCA	1 cut(s)	167
MnlI	CCTC	1 cut(s)	67
Mox20I	TGGCCA	1 cut(s)	167
MscI	TGGCCA	1 cut(s)	167
MseI	TTAA	2 cut(s)	125, 259
MslI	CAYNNNNRTG	1 cut(s)	69
Msp20I	TGGCCA	1 cut(s)	167
NdeII	GATC	2 cut(s)	38, 144
PflFI	GACNNNGTC	1 cut(s)	156
PsyI	GACNNNGTC	1 cut(s)	156
RseI	CAYNNNNRTG	1 cut(s)	69
SaqAI	TTAA	2 cut(s)	125, 259
Sau3AI	GATC	2 cut(s)	38, 144
SetI	ASST	4 cut(s)	49, 119, 131, 160
SgeI	CNNG	7 cut(s)	37, 96, 120, 160, 173, 187, 253
SmiMI	CAYNNNNRTG	1 cut(s)	69
Sse9I	AATT	2 cut(s)	136, 197
TaiI	ACGT	2 cut(s)	119, 160
TaqI	TCGA	1 cut(s)	160
TasI	AATT	2 cut(s)	136, 197
Tru1I	TTAA	2 cut(s)	125, 259
Tru9I	TTAA	2 cut(s)	125, 259
TspGWI	ACGGA	1 cut(s)	51
Tth111I	GACNNNGTC	1 cut(s)	156
XapI	RAATTY	1 cut(s)	136

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.