AT5G15160

Transcription factor

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Reverse (-)
4921243 .. 4922812
1570 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G15160.1

Sequence Viewer

Length: 285 bp
ATGTCTTCTAGCAGAAGGTCGAGACAAGCAAGCTCATCATCAAGAATTAGCGATGACCAGATCACTGATCTCATCTCAAAGCTCCGACAGTCCATTCCGGAGATTCGCCAGAACCGTCGTTCCAACACGGTATCAGCGTCGAAAGTGTTACAAGAGACTTGCAACTACATAAGAAACTTGAACAAGGAAGCCGATGACCTCAGTGATCGATTGACTCAGCTTCTGGAATCCATTGATCCTAATAGCCCACAAGCCGCAGTTATTAGGAGCTTGATTAATGGATAA

Protein Analysis

94

Amino Acids

10.55

Weight (kDa)

9.61

Isoelectric Point (pI)

84.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
bHLH_ILI PF23174 17 - 92 2.5e-27 ILI bHLH domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 97
AciI CCGC 1 cut(s) 255
AclWI GGATC 1 cut(s) 230
AgsI TTSAA 1 cut(s) 181
AloI GAACNNNNNNTCC 2 cut(s) 104, 136
AluBI AGCT 4 cut(s) 33, 82, 220, 270
AluI AGCT 4 cut(s) 33, 82, 220, 270
Alw26I GTCTC 2 cut(s) 16, 149
AlwI GGATC 1 cut(s) 230
AlwNI CAGNNNCTG 1 cut(s) 223
Aor13HI TCCGGA 1 cut(s) 97
AseI ATTAAT 1 cut(s) 276
BcoDI GTCTC 2 cut(s) 16, 149
BfaI CTAG 1 cut(s) 9
BisI GCNGC 1 cut(s) 255
BlsI GCNGC 1 cut(s) 256
Bsa29I ATCGAT 1 cut(s) 208
BsaWI WCCGGW 1 cut(s) 97
BseAI TCCGGA 1 cut(s) 97
BseCI ATCGAT 1 cut(s) 208
BseMII CTCAG 2 cut(s) 214, 230
BshVI ATCGAT 1 cut(s) 208
BsiSI CCGG 1 cut(s) 98
BsmAI GTCTC 2 cut(s) 16, 149
Bsp13I TCCGGA 1 cut(s) 97
Bsp143I GATC 4 cut(s) 60, 67, 205, 235
BspACI CCGC 1 cut(s) 255
BspCNI CTCAG 2 cut(s) 213, 229
BspDI ATCGAT 1 cut(s) 208
BspEI TCCGGA 1 cut(s) 97
BspPI GGATC 1 cut(s) 230
BssMI GATC 4 cut(s) 60, 67, 205, 235
Bst4CI ACNGT 3 cut(s) 90, 116, 130
BstC8I GCNNGC 1 cut(s) 31
BstDEI CTNAG 2 cut(s) 200, 216
BstKTI GATC 4 cut(s) 63, 70, 208, 238
BstMAI GTCTC 2 cut(s) 16, 149
BstMBI GATC 4 cut(s) 60, 67, 205, 235
Bsu15I ATCGAT 1 cut(s) 208
BsuTUI ATCGAT 1 cut(s) 208
BtgZI GCGATG 1 cut(s) 66
BtsIMutI CAGTG 2 cut(s) 63, 208
Cac8I GCNNGC 1 cut(s) 31
CaiI CAGNNNCTG 1 cut(s) 223
ClaI ATCGAT 1 cut(s) 208
CseI GACGC 1 cut(s) 126
CviJI RGCY 7 cut(s) 33, 82, 191, 220, 246, 254, 270
CviKI_1 RGCY 7 cut(s) 33, 82, 191, 220, 246, 254, 270
DdeI CTNAG 2 cut(s) 200, 216
DpnI GATC 4 cut(s) 62, 69, 207, 237
DpnII GATC 4 cut(s) 60, 67, 205, 235
FaiI YATR 1 cut(s) 170
Fnu4HI GCNGC 1 cut(s) 255
Fsp4HI GCNGC 1 cut(s) 255
FspBI CTAG 1 cut(s) 9
GluI GCNGC 1 cut(s) 255
HapII CCGG 1 cut(s) 98
HgaI GACGC 1 cut(s) 126
HinfI GANTC 3 cut(s) 103, 214, 227
HpaII CCGG 1 cut(s) 98
Hpy188I TCNGA 1 cut(s) 86
Hpy188III TCNNGA 4 cut(s) 21, 42, 98, 224
Hpy99I CGWCG 2 cut(s) 120, 142
HpyAV CCTTC 1 cut(s) 9
HpyCH4III ACNGT 3 cut(s) 90, 116, 130
HpyCH4V TGCA 1 cut(s) 162
HpyF3I CTNAG 2 cut(s) 200, 216
Kpn2I TCCGGA 1 cut(s) 97
Kzo9I GATC 4 cut(s) 60, 67, 205, 235
LmnI GCTCC 2 cut(s) 87, 267
LpnPI CCDG 4 cut(s) 71, 111, 122, 209
MaeI CTAG 1 cut(s) 9
MaeIII GTNAC 1 cut(s) 147
MalI GATC 4 cut(s) 62, 69, 207, 237
MboI GATC 4 cut(s) 60, 67, 205, 235
MluCI AATT 1 cut(s) 45
MlyI GAGTC 1 cut(s) 208
MmeI TCCRAC 2 cut(s) 109, 147
MnlI CCTC 1 cut(s) 209
MroI TCCGGA 1 cut(s) 97
MseI TTAA 1 cut(s) 276
MspI CCGG 1 cut(s) 98
NdeII GATC 4 cut(s) 60, 67, 205, 235
PcsI WCGNNNNNNNCGW 2 cut(s) 112, 134
PfeI GAWTC 2 cut(s) 103, 227
PkrI GCNGC 1 cut(s) 256
PleI GAGTC 1 cut(s) 208
PpsI GAGTC 1 cut(s) 208
PshBI ATTAAT 1 cut(s) 276
PstNI CAGNNNCTG 1 cut(s) 223
SaqAI TTAA 1 cut(s) 276
SatI GCNGC 1 cut(s) 255
Sau3AI GATC 4 cut(s) 60, 67, 205, 235
SchI GAGTC 1 cut(s) 208
SetI ASST 6 cut(s) 20, 35, 84, 201, 222, 272
Sse9I AATT 1 cut(s) 45
SsiI CCGC 1 cut(s) 255
SspMI CTAG 1 cut(s) 9
TaaI ACNGT 3 cut(s) 90, 116, 130
TaqI TCGA 3 cut(s) 20, 140, 208
TasI AATT 1 cut(s) 45
TauI GCSGC 1 cut(s) 257
TfiI GAWTC 2 cut(s) 103, 227
Tru1I TTAA 1 cut(s) 276
Tru9I TTAA 1 cut(s) 276
TscAI CASTG 2 cut(s) 70, 208
TspRI CASTG 2 cut(s) 70, 208
VspI ATTAAT 1 cut(s) 276
XspI CTAG 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.