AT5G20935

Protein of unknown function (DUF3148)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0014319
Physical Location & Seq
Forward (+)
7103384 .. 7103945
562 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G20935.1

Sequence Viewer

Length: 366 bp
ATGGCTTTATCTTTTGTTTCTTCAACTAGATTCTCCAAGATGCAATATGGCATATGGCACAGTGGATCCTTCACGCAACGAGTCAGTGTGAGATGCTGTGAAATCGCAAACGAGGCTCCACGACCAAAATCGAAGCTCCAAGTAGGATCACCGATCATCATCGTCGAAGCTCCCAAAGTTATAAAAACGGCCGCTTCAATGCCTTGCCTTAGGGCCAACTCTGGCTTGGTCAAGCCTGGCGATGTTGGAAGAATCGTGTCGAGAAAACCAAAGGACTTGTGGGCAGTTAGACTCTCCATTGGAACATATCTTTTAGATGGTAAATATTTCAAAGCTTTAGAGCTTGACGAAGGAGATAGTGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF3148

Protein Analysis

121

Amino Acids

13.27

Weight (kDa)

9.58

Isoelectric Point (pI)

26.4

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CRR42-like PF11347 48 - 110 2.8e-26 Protein CHLORORESPIRATORY REDUCTION 42-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014319)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G20935 AT5G20935
fragaria_vesca FvH4_3g26950
malus_domestica MD03G1161500.v1.1
prunus_persica Prupe.6G149700_v2.0.a1 Prupe.6G149700_v2.0.a1
pyrus_communis pycom03g11380
rosa_chinensis RchiOBHm_Chr5g0049391
rosa_laevigata RLG00000034616
rosa_multiflora Rmu_sc0001307.1_g000005 Rmu_sc0014052.1_g000011
rosa_roxburghii Rroxscaffold_1G00032300
rosa_rugosa Rorug05G0248200
rosa_samantha Rh5AG324600 Rh5CG360400 Rh5DG348000
rosa_wichuraiana Rw5G030670

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 182
AciI CCGC 1 cut(s) 192
AclWI GGATC 3 cut(s) 60, 73, 154
AcoI YGGCCR 1 cut(s) 189
AgsI TTSAA 3 cut(s) 24, 198, 331
AjnI CCWGG 1 cut(s) 235
AluBI AGCT 4 cut(s) 136, 170, 335, 343
AluI AGCT 4 cut(s) 136, 170, 335, 343
AlwI GGATC 3 cut(s) 60, 73, 154
AoxI GGCC 2 cut(s) 189, 213
AspS9I GGNCC 1 cut(s) 213
AsuHPI GGTGA 1 cut(s) 141
AxyI CCTNAGG 1 cut(s) 209
BamHI GGATCC 1 cut(s) 65
BccI CCATC 1 cut(s) 311
BceAI ACGGC 1 cut(s) 204
BciT130I CCWGG 1 cut(s) 237
BfaI CTAG 1 cut(s) 27
BisI GCNGC 1 cut(s) 192
BlsI GCNGC 1 cut(s) 193
Bme1390I CCNGG 1 cut(s) 237
BmgT120I GGNCC 1 cut(s) 213
BmiI GGNNCC 2 cut(s) 67, 117
BmrFI CCNGG 1 cut(s) 237
BmsI GCATC 2 cut(s) 30, 83
BsaBI GATNNNNATC 1 cut(s) 158
Bse21I CCTNAGG 1 cut(s) 209
Bse8I GATNNNNATC 1 cut(s) 158
BseBI CCWGG 1 cut(s) 237
BseJI GATNNNNATC 1 cut(s) 158
BseX3I CGGCCG 1 cut(s) 189
Bsh1285I CGRYCG 1 cut(s) 192
BshFI GGCC 2 cut(s) 191, 215
BsiEI CGRYCG 1 cut(s) 192
BsnI GGCC 2 cut(s) 191, 215
Bsp143I GATC 3 cut(s) 65, 146, 153
BspACI CCGC 1 cut(s) 192
BspANI GGCC 2 cut(s) 191, 215
BspLI GGNNCC 2 cut(s) 67, 117
BspPI GGATC 3 cut(s) 60, 73, 154
BssMI GATC 3 cut(s) 65, 146, 153
Bst2UI CCWGG 1 cut(s) 237
Bst4CI ACNGT 1 cut(s) 62
BstDEI CTNAG 1 cut(s) 209
BstKTI GATC 3 cut(s) 68, 149, 156
BstMBI GATC 3 cut(s) 65, 146, 153
BstMCI CGRYCG 1 cut(s) 192
BstMWI GCNNNNNNNGC 1 cut(s) 113
BstNI CCWGG 1 cut(s) 237
BstSCI CCNGG 1 cut(s) 235
BstX2I RGATCY 1 cut(s) 65
BstYI RGATCY 1 cut(s) 65
BstZI CGGCCG 1 cut(s) 189
Bsu36I CCTNAGG 1 cut(s) 209
BsuRI GGCC 2 cut(s) 191, 215
BtgZI GCGATG 1 cut(s) 255
BtsIMutI CAGTG 2 cut(s) 67, 91
Cfr13I GGNCC 1 cut(s) 213
DdeI CTNAG 1 cut(s) 209
DpnI GATC 3 cut(s) 67, 148, 155
DpnII GATC 3 cut(s) 65, 146, 153
EaeI YGGCCR 1 cut(s) 189
EagI CGGCCG 1 cut(s) 189
EclXI CGGCCG 1 cut(s) 189
Eco52I CGGCCG 1 cut(s) 189
Eco81I CCTNAGG 1 cut(s) 209
EcoRII CCWGG 1 cut(s) 235
FaiI YATR 5 cut(s) 48, 53, 55, 182, 307
FauNDI CATATG 1 cut(s) 53
Fnu4HI GCNGC 1 cut(s) 192
Fsp4HI GCNGC 1 cut(s) 192
FspBI CTAG 1 cut(s) 27
GluI GCNGC 1 cut(s) 192
HaeIII GGCC 2 cut(s) 191, 215
HindIII AAGCTT 1 cut(s) 333
HinfI GANTC 4 cut(s) 30, 81, 252, 291
HphI GGTGA 1 cut(s) 141
Hpy188III TCNNGA 1 cut(s) 261
Hpy99I CGWCG 1 cut(s) 167
HpyAV CCTTC 2 cut(s) 79, 344
HpyCH4III ACNGT 1 cut(s) 62
HpyCH4V TGCA 1 cut(s) 43
HpyF10VI GCNNNNNNNGC 1 cut(s) 113
HpyF3I CTNAG 1 cut(s) 209
Kzo9I GATC 3 cut(s) 65, 146, 153
LmnI GCTCC 3 cut(s) 121, 141, 175
LpnPI CCDG 3 cut(s) 207, 222, 249
LweI GCATC 2 cut(s) 30, 83
MaeI CTAG 1 cut(s) 27
MalI GATC 3 cut(s) 67, 148, 155
MboI GATC 3 cut(s) 65, 146, 153
MboII GAAGA 2 cut(s) 12, 261
MflI RGATCY 1 cut(s) 65
MlyI GAGTC 2 cut(s) 90, 285
MmeI TCCRAC 1 cut(s) 226
MnlI CCTC 1 cut(s) 106
MspR9I CCNGG 1 cut(s) 237
MvaI CCWGG 1 cut(s) 237
MwoI GCNNNNNNNGC 1 cut(s) 113
NdeI CATATG 1 cut(s) 53
NdeII GATC 3 cut(s) 65, 146, 153
NlaIV GGNNCC 2 cut(s) 67, 117
PfeI GAWTC 2 cut(s) 30, 252
PkrI GCNGC 1 cut(s) 193
PleI GAGTC 2 cut(s) 89, 285
PpsI GAGTC 2 cut(s) 89, 285
PsiI TTATAA 1 cut(s) 182
Psp6I CCWGG 1 cut(s) 235
PspGI CCWGG 1 cut(s) 235
PspN4I GGNNCC 2 cut(s) 67, 117
PspPI GGNCC 1 cut(s) 213
PsuI RGATCY 1 cut(s) 65
SatI GCNGC 1 cut(s) 192
Sau3AI GATC 3 cut(s) 65, 146, 153
Sau96I GGNCC 1 cut(s) 213
SchI GAGTC 2 cut(s) 90, 285
ScrFI CCNGG 1 cut(s) 237
SetI ASST 4 cut(s) 138, 172, 337, 345
SfaNI GCATC 2 cut(s) 30, 83
SsiI CCGC 1 cut(s) 192
SspI AATATT 1 cut(s) 326
SspMI CTAG 1 cut(s) 27
StyD4I CCNGG 1 cut(s) 235
TaaI ACNGT 1 cut(s) 62
TaqI TCGA 3 cut(s) 131, 165, 260
TauI GCSGC 1 cut(s) 194
TfiI GAWTC 2 cut(s) 30, 252
TscAI CASTG 2 cut(s) 67, 91
TspRI CASTG 2 cut(s) 67, 91
XcmI CCANNNNNNNNNTGG 2 cut(s) 223, 276
XspI CTAG 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.