AT5G46770

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0015976
Physical Location & Seq
Forward (+)
18977399 .. 18978246
848 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G46770.1

Sequence Viewer

Length: 402 bp
ATGAGCCTAAATTGTCTATCATGTCAAGCCCTTCCACGAACAGATTCCAACAAAGATGTTGATCTCTCCGGTCCTGGACCACCAAGGGTCGAGATTAACAATGTTCTAGGTAAAACATGTTGTGTAAATCCTATTGGTGGGAGAAATTGGTCAGGGAATTTGAGTCCTAGGATCTATGAGAAGATTGGACGGCCAGGATCGTCTTTAGCGCATAAGATGAAGAAGGTGAAAAAGATTCATCACGTTAGGCTAAGTGGTCCTGTTGGTTCTAGCCCTAGCAATGTACCAACCCGGCCGGAACAACCAAAGCTCGTAAGGAGCACTGGAGTCCGAAGGAATTGGAGTTTTGAGAATTTGAGAGATCAAGGATTAATAGAAGAAAAAAGGAAGATTAACATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

133

Amino Acids

14.7

Weight (kDa)

10.29

Isoelectric Point (pI)

61.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015976)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G35215 AT5G46770
fragaria_vesca FvH4_5g22090
malus_domestica MD16G1274300.v1.1
prunus_persica Prupe.5G036400_v2.0.a1
rosa_chinensis RchiOBHm_Chr7g0209741
rosa_laevigata RLG00000003097
rosa_multiflora Rmu_sc0002616.1_g000018
rosa_roxburghii Rroxscaffold_3G00249110
rosa_rugosa Rorug07G0116000
rosa_samantha Rh7AG249500 Rh7BG243400 Rh7CG265500 Rh7DG255300
rosa_wichuraiana Rw7G021150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 179, 205
AcoI YGGCCR 2 cut(s) 191, 293
AcsI RAATTY 2 cut(s) 157, 352
AfaI GTAC 1 cut(s) 285
AfiI CCNNNNNNNGG 1 cut(s) 137
AflIII ACRYGT 1 cut(s) 116
AjnI CCWGG 2 cut(s) 73, 193
AluBI AGCT 1 cut(s) 310
AluI AGCT 1 cut(s) 310
Alw21I GWGCWC 1 cut(s) 323
AlwI GGATC 2 cut(s) 179, 205
AoxI GGCC 2 cut(s) 191, 293
ApoI RAATTY 2 cut(s) 157, 352
AseI ATTAAT 1 cut(s) 371
Asp700I GAANNNNTTC 1 cut(s) 43
AspA2I CCTAGG 1 cut(s) 167
AspLEI GCGC 1 cut(s) 211
AspS9I GGNCC 3 cut(s) 71, 77, 257
AsuC2I CCSGG 1 cut(s) 292
AsuHPI GGTGA 1 cut(s) 238
AvaII GGWCC 3 cut(s) 71, 77, 257
AvrII CCTAGG 1 cut(s) 167
Bbv12I GWGCWC 1 cut(s) 323
BceAI ACGGC 1 cut(s) 206
BciT130I CCWGG 2 cut(s) 75, 195
BcnI CCSGG 1 cut(s) 292
BfaI CTAG 4 cut(s) 107, 168, 270, 276
BlnI CCTAGG 1 cut(s) 167
Bme1390I CCNGG 3 cut(s) 75, 195, 292
Bme18I GGWCC 3 cut(s) 71, 77, 257
BmgT120I GGNCC 3 cut(s) 71, 77, 257
BmrFI CCNGG 3 cut(s) 75, 195, 292
BpmI CTGGAG 1 cut(s) 345
BpuMI CCSGG 1 cut(s) 292
BsaBI GATNNNNATC 1 cut(s) 60
BsaJI CCNNGG 2 cut(s) 83, 167
BsaWI WCCGGW 1 cut(s) 68
Bsc4I CCNNNNNNNGG 1 cut(s) 137
Bse1I ACTGG 1 cut(s) 328
Bse3DI GCAATG 1 cut(s) 286
Bse8I GATNNNNATC 1 cut(s) 60
BseBI CCWGG 2 cut(s) 75, 195
BseDI CCNNGG 2 cut(s) 83, 167
BseJI GATNNNNATC 1 cut(s) 60
BseLI CCNNNNNNNGG 1 cut(s) 137
BseMI GCAATG 1 cut(s) 286
BseNI ACTGG 1 cut(s) 328
BseX3I CGGCCG 1 cut(s) 293
Bsh1285I CGRYCG 1 cut(s) 296
BshFI GGCC 2 cut(s) 193, 295
BsiEI CGRYCG 1 cut(s) 296
BsiHKAI GWGCWC 1 cut(s) 323
BsiSI CCGG 3 cut(s) 69, 292, 296
BslI CCNNNNNNNGG 1 cut(s) 137
BsnI GGCC 2 cut(s) 193, 295
Bsp1286I GDGCHC 1 cut(s) 323
Bsp143I GATC 4 cut(s) 61, 171, 197, 361
BspANI GGCC 2 cut(s) 193, 295
BspPI GGATC 2 cut(s) 179, 205
BsrDI GCAATG 1 cut(s) 286
BsrI ACTGG 1 cut(s) 328
BssECI CCNNGG 2 cut(s) 83, 167
BssMI GATC 4 cut(s) 61, 171, 197, 361
BssT1I CCWWGG 2 cut(s) 83, 167
Bst2UI CCWGG 2 cut(s) 75, 195
BstDEI CTNAG 1 cut(s) 251
BstHHI GCGC 1 cut(s) 211
BstKTI GATC 4 cut(s) 64, 174, 200, 364
BstMBI GATC 4 cut(s) 61, 171, 197, 361
BstMCI CGRYCG 1 cut(s) 296
BstNI CCWGG 2 cut(s) 75, 195
BstNSI RCATGY 1 cut(s) 120
BstSCI CCNGG 3 cut(s) 73, 193, 290
BstX2I RGATCY 1 cut(s) 171
BstYI RGATCY 1 cut(s) 171
BstZI CGGCCG 1 cut(s) 293
BsuRI GGCC 2 cut(s) 193, 295
BtsIMutI CAGTG 1 cut(s) 321
CfoI GCGC 1 cut(s) 211
Cfr13I GGNCC 3 cut(s) 71, 77, 257
Csp6I GTAC 1 cut(s) 284
CviAII CATG 2 cut(s) 21, 117
CviJI RGCY 7 cut(s) 6, 29, 193, 250, 273, 295, 310
CviKI_1 RGCY 7 cut(s) 6, 29, 193, 250, 273, 295, 310
CviQI GTAC 1 cut(s) 284
DdeI CTNAG 1 cut(s) 251
DpnI GATC 4 cut(s) 63, 173, 199, 363
DpnII GATC 4 cut(s) 61, 171, 197, 361
EaeI YGGCCR 2 cut(s) 191, 293
EagI CGGCCG 1 cut(s) 293
EclXI CGGCCG 1 cut(s) 293
Eco130I CCWWGG 2 cut(s) 83, 167
Eco47I GGWCC 3 cut(s) 71, 77, 257
Eco52I CGGCCG 1 cut(s) 293
EcoRII CCWGG 2 cut(s) 73, 193
EcoT14I CCWWGG 2 cut(s) 83, 167
ErhI CCWWGG 2 cut(s) 83, 167
FaeI CATG 2 cut(s) 24, 120
FaiI YATR 6 cut(s) 22, 118, 177, 213, 398, 400
FatI CATG 2 cut(s) 20, 116
FauNDI CATATG 1 cut(s) 398
FspBI CTAG 4 cut(s) 107, 168, 270, 276
GlaI GCGC 1 cut(s) 210
GsuI CTGGAG 1 cut(s) 345
HaeIII GGCC 2 cut(s) 193, 295
HapII CCGG 3 cut(s) 69, 292, 296
HhaI GCGC 1 cut(s) 211
Hin1II CATG 2 cut(s) 24, 120
Hin6I GCGC 1 cut(s) 209
HinP1I GCGC 1 cut(s) 209
HinfI GANTC 4 cut(s) 44, 163, 235, 327
HpaII CCGG 3 cut(s) 69, 292, 296
HphI GGTGA 1 cut(s) 238
Hpy188I TCNGA 1 cut(s) 332
Hpy188III TCNNGA 1 cut(s) 91
HpyAV CCTTC 3 cut(s) 41, 217, 327
HpyCH4IV ACGT 1 cut(s) 243
HpyF3I CTNAG 1 cut(s) 251
HpySE526I ACGT 1 cut(s) 243
Hsp92II CATG 2 cut(s) 24, 120
HspAI GCGC 1 cut(s) 209
Kzo9I GATC 4 cut(s) 61, 171, 197, 361
LmnI GCTCC 1 cut(s) 318
MaeI CTAG 4 cut(s) 107, 168, 270, 276
MaeII ACGT 1 cut(s) 243
MalI GATC 4 cut(s) 63, 173, 199, 363
MboI GATC 4 cut(s) 61, 171, 197, 361
MboII GAAGA 4 cut(s) 193, 232, 389, 400
MflI RGATCY 1 cut(s) 171
MhlI GDGCHC 1 cut(s) 323
MluCI AATT 5 cut(s) 10, 145, 157, 337, 352
MlyI GAGTC 2 cut(s) 172, 336
MmeI TCCRAC 1 cut(s) 72
MroXI GAANNNNTTC 1 cut(s) 43
MseI TTAA 3 cut(s) 96, 371, 393
MspI CCGG 3 cut(s) 69, 292, 296
MspR9I CCNGG 3 cut(s) 75, 195, 292
MvaI CCWGG 2 cut(s) 75, 195
NciI CCSGG 1 cut(s) 292
NdeI CATATG 1 cut(s) 398
NdeII GATC 4 cut(s) 61, 171, 197, 361
NlaIII CATG 2 cut(s) 24, 120
NspI RCATGY 1 cut(s) 120
PciI ACATGT 1 cut(s) 116
PdmI GAANNNNTTC 1 cut(s) 43
PfeI GAWTC 2 cut(s) 44, 235
PfoI TCCNGGA 1 cut(s) 73
PleI GAGTC 2 cut(s) 171, 335
PpsI GAGTC 2 cut(s) 171, 335
PscI ACATGT 1 cut(s) 116
PshBI ATTAAT 1 cut(s) 371
Psp6I CCWGG 2 cut(s) 73, 193
PspGI CCWGG 2 cut(s) 73, 193
PspPI GGNCC 3 cut(s) 71, 77, 257
PsuI RGATCY 1 cut(s) 171
RsaI GTAC 1 cut(s) 285
RsaNI GTAC 1 cut(s) 284
SaqAI TTAA 3 cut(s) 96, 371, 393
Sau3AI GATC 4 cut(s) 61, 171, 197, 361
Sau96I GGNCC 3 cut(s) 71, 77, 257
SchI GAGTC 2 cut(s) 172, 336
ScrFI CCNGG 3 cut(s) 75, 195, 292
SduI GDGCHC 1 cut(s) 323
SetI ASST 4 cut(s) 112, 228, 246, 312
SinI GGWCC 3 cut(s) 71, 77, 257
Sse9I AATT 5 cut(s) 10, 145, 157, 337, 352
SspMI CTAG 4 cut(s) 107, 168, 270, 276
StyD4I CCNGG 3 cut(s) 73, 193, 290
StyI CCWWGG 2 cut(s) 83, 167
TaiI ACGT 1 cut(s) 246
TaqI TCGA 1 cut(s) 90
TasI AATT 5 cut(s) 10, 145, 157, 337, 352
TfiI GAWTC 2 cut(s) 44, 235
Tru1I TTAA 3 cut(s) 96, 371, 393
Tru9I TTAA 3 cut(s) 96, 371, 393
TscAI CASTG 1 cut(s) 328
TspDTI ATGAA 2 cut(s) 227, 233
TspRI CASTG 1 cut(s) 328
VpaK11BI GGWCC 3 cut(s) 71, 77, 257
VspI ATTAAT 1 cut(s) 371
XapI RAATTY 2 cut(s) 157, 352
XceI RCATGY 1 cut(s) 120
XmaJI CCTAGG 1 cut(s) 167
XmnI GAANNNNTTC 1 cut(s) 43
XspI CTAG 4 cut(s) 107, 168, 270, 276
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.