AT5G55410

Protease inhibitor seed storage lipid transfer protein

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Forward (+)
22460550 .. 22461385
836 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G55410.2

Sequence Viewer

Length: 324 bp
ATGGGTAAGAACAATACCAAATTCCTTATGCAATTTGCAACTTTTGCAATGGTTTTAACCTTTGCGATGATGGTCAAAGAAGCTACAAGCATGTCCATTTGTGACATGGACATAAATGATATGCAGAAATGTCGCCCAGCCATCACTGGAAACAATCCCCCACCTCCCGTCAATGATTGCTGCGTAGTGGTTCGGAAAGCTAATTTCGAATGCTTATGCAGATTTAAGTTTTATCTCCCAATTTTACGAATTGATCCATCTAAAGTCGTGGCTCTTGTAGCTAAATGTGGTGTTACAACAGTCCCTCGTTCTTGCCAAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

11.92

Weight (kDa)

9.03

Isoelectric Point (pI)

40.72

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LTP_2 PF14368 17 - 105 1.4e-10 Probable lipid transfer
Tryp_alpha_amyl PF00234 34 - 102 5.8e-07 Protease inhibitor/seed storage/LTP family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011680)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 248
AcsI RAATTY 1 cut(s) 20
AluBI AGCT 3 cut(s) 83, 200, 281
AluI AGCT 3 cut(s) 83, 200, 281
AlwI GGATC 1 cut(s) 248
ApeKI GCWGC 1 cut(s) 180
ApoI RAATTY 1 cut(s) 20
AsuII TTCGAA 1 cut(s) 207
BbvI GCAGC 1 cut(s) 167
BccI CCATC 3 cut(s) 64, 149, 265
BcgI CGANNNNNNTGC 2 cut(s) 113, 147
BisI GCNGC 1 cut(s) 181
BlsI GCNGC 1 cut(s) 182
Bpu14I TTCGAA 1 cut(s) 207
Bse1I ACTGG 1 cut(s) 151
Bse3DI GCAATG 1 cut(s) 54
BseMI GCAATG 1 cut(s) 54
BseNI ACTGG 1 cut(s) 151
BseXI GCAGC 1 cut(s) 167
BseYI CCCAGC 1 cut(s) 136
BslFI GGGAC 1 cut(s) 287
BsmFI GGGAC 1 cut(s) 287
BsmI GAATGC 1 cut(s) 215
Bsp119I TTCGAA 1 cut(s) 207
Bsp143I GATC 1 cut(s) 253
BspPI GGATC 1 cut(s) 248
BspT104I TTCGAA 1 cut(s) 207
BsrDI GCAATG 1 cut(s) 54
BsrI ACTGG 1 cut(s) 151
BssMI GATC 1 cut(s) 253
Bst4CI ACNGT 1 cut(s) 301
BstAPI GCANNNNNTGC 1 cut(s) 44
BstBI TTCGAA 1 cut(s) 207
BstKTI GATC 1 cut(s) 256
BstMBI GATC 1 cut(s) 253
BstMWI GCNNNNNNNGC 2 cut(s) 44, 278
BstNSI RCATGY 1 cut(s) 94
BstV1I GCAGC 1 cut(s) 167
BtgZI GCGATG 1 cut(s) 80
BtsIMutI CAGTG 1 cut(s) 144
CviAII CATG 2 cut(s) 91, 106
CviJI RGCY 5 cut(s) 83, 140, 200, 272, 281
CviKI_1 RGCY 5 cut(s) 83, 140, 200, 272, 281
DpnI GATC 1 cut(s) 255
DpnII GATC 1 cut(s) 253
FaeI CATG 2 cut(s) 94, 109
FaiI YATR 6 cut(s) 29, 92, 107, 113, 122, 217
FaqI GGGAC 1 cut(s) 287
FatI CATG 2 cut(s) 90, 105
Fnu4HI GCNGC 1 cut(s) 181
Fsp4HI GCNGC 1 cut(s) 181
GluI GCNGC 1 cut(s) 181
GsaI CCCAGC 1 cut(s) 140
Hin1II CATG 2 cut(s) 94, 109
Hpy188I TCNGA 1 cut(s) 195
HpyCH4III ACNGT 1 cut(s) 301
HpyCH4V TGCA 5 cut(s) 31, 38, 47, 124, 219
HpyF10VI GCNNNNNNNGC 2 cut(s) 44, 278
Hsp92II CATG 2 cut(s) 94, 109
Kzo9I GATC 1 cut(s) 253
LpnPI CCDG 2 cut(s) 132, 150
Lsp1109I GCAGC 1 cut(s) 167
MaeIII GTNAC 2 cut(s) 101, 292
MalI GATC 1 cut(s) 255
MboI GATC 1 cut(s) 253
MluCI AATT 5 cut(s) 20, 32, 202, 240, 249
MnlI CCTC 2 cut(s) 174, 315
MseI TTAA 2 cut(s) 56, 225
Mva1269I GAATGC 1 cut(s) 215
MwoI GCNNNNNNNGC 2 cut(s) 44, 278
NdeII GATC 1 cut(s) 253
NlaIII CATG 2 cut(s) 94, 109
NmuCI GTSAC 1 cut(s) 101
NspI RCATGY 1 cut(s) 94
NspV TTCGAA 1 cut(s) 207
PctI GAATGC 1 cut(s) 215
PkrI GCNGC 1 cut(s) 182
PspFI CCCAGC 1 cut(s) 136
SaqAI TTAA 2 cut(s) 56, 225
SatI GCNGC 1 cut(s) 181
Sau3AI GATC 1 cut(s) 253
SetI ASST 5 cut(s) 62, 85, 166, 202, 283
SfuI TTCGAA 1 cut(s) 207
SgeI CNNG 9 cut(s) 99, 103, 118, 149, 159, 179, 280, 287, 318
Sse9I AATT 5 cut(s) 20, 32, 202, 240, 249
TaaI ACNGT 1 cut(s) 301
TaqI TCGA 1 cut(s) 207
TasI AATT 5 cut(s) 20, 32, 202, 240, 249
Tru1I TTAA 2 cut(s) 56, 225
Tru9I TTAA 2 cut(s) 56, 225
TscAI CASTG 1 cut(s) 151
TseFI GTSAC 1 cut(s) 101
TseI GCWGC 1 cut(s) 180
Tsp45I GTSAC 1 cut(s) 101
TspRI CASTG 1 cut(s) 151
XapI RAATTY 1 cut(s) 20
XceI RCATGY 1 cut(s) 94
XcmI CCANNNNNNNNNTGG 1 cut(s) 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.