AT5G55460

Protease inhibitor seed storage lipid transfer protein

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Forward (+)
22468579 .. 22469304
726 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G55460.1

Sequence Viewer

Length: 330 bp
ATGGATACGAACAATACCAGAACTGTGAAATTTGCAGCTCTTGCAATAGTTTTAGCCGCCTTGGTGTTGATGGAAGAACCTACGAGCATTACCGCATGTAACATCAACGCAAACCATCTGGAAAAATGTCGTCCAGCCGTAATTGGAGACAACCCGCCATCTCCAATCAAAGAGTGTTGTGAACTCCTCCAAGCCGCTAATCTGAAATGCATCTGCAGATTCAAGTCTGTTCTCCCCGTTTTAGCGGTTTACCCATCTAAAGTCCAGGCTCTTCTGAGCAAATGTGGCCTGACAACAATCCCTCCTGCTTGCCAAGCTTTGAGGAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

11.69

Weight (kDa)

8.69

Isoelectric Point (pI)

47.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011680)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 5 cut(s) 57, 93, 155, 195, 245
AcsI RAATTY 1 cut(s) 29
AgsI TTSAA 1 cut(s) 223
AjnI CCWGG 1 cut(s) 264
AluBI AGCT 2 cut(s) 38, 317
AluI AGCT 2 cut(s) 38, 317
Alw26I GTCTC 1 cut(s) 141
AoxI GGCC 1 cut(s) 286
ApeKI GCWGC 1 cut(s) 35
ApoI RAATTY 1 cut(s) 29
BbvI GCAGC 1 cut(s) 47
BccI CCATC 4 cut(s) 64, 123, 166, 262
BceAI ACGGC 1 cut(s) 122
BciT130I CCWGG 1 cut(s) 266
BcoDI GTCTC 1 cut(s) 141
BfmI CTRYAG 1 cut(s) 214
BisI GCNGC 3 cut(s) 36, 57, 195
BlsI GCNGC 3 cut(s) 37, 58, 196
Bme1390I CCNGG 1 cut(s) 266
BmrFI CCNGG 1 cut(s) 266
BmsI GCATC 1 cut(s) 219
BsaJI CCNNGG 1 cut(s) 60
BsaXI ACNNNNNCTCC 2 cut(s) 286, 316
BseBI CCWGG 1 cut(s) 266
BseDI CCNNGG 1 cut(s) 60
BseMII CTCAG 1 cut(s) 266
BseRI GAGGAG 1 cut(s) 176
BseXI GCAGC 1 cut(s) 47
BshFI GGCC 1 cut(s) 288
BsmAI GTCTC 1 cut(s) 141
BsnI GGCC 1 cut(s) 288
BspACI CCGC 5 cut(s) 57, 93, 155, 195, 245
BspANI GGCC 1 cut(s) 288
BspCNI CTCAG 1 cut(s) 267
BspMAI CTGCAG 1 cut(s) 218
BspQI GCTCTTC 1 cut(s) 276
BssECI CCNNGG 1 cut(s) 60
BssT1I CCWWGG 1 cut(s) 60
Bst2UI CCWGG 1 cut(s) 266
Bst4CI ACNGT 1 cut(s) 25
Bst6I CTCTTC 1 cut(s) 276
BstAPI GCANNNNNTGC 1 cut(s) 41
BstC8I GCNNGC 1 cut(s) 310
BstDEI CTNAG 1 cut(s) 275
BstMAI GTCTC 1 cut(s) 141
BstMWI GCNNNNNNNGC 3 cut(s) 41, 285, 314
BstNI CCWGG 1 cut(s) 266
BstNSI RCATGY 1 cut(s) 99
BstSCI CCNGG 1 cut(s) 264
BstSFI CTRYAG 1 cut(s) 214
BstV1I GCAGC 1 cut(s) 47
BsuRI GGCC 1 cut(s) 288
Cac8I GCNNGC 1 cut(s) 310
CviAII CATG 1 cut(s) 96
CviJI RGCY 7 cut(s) 38, 56, 137, 194, 269, 288, 317
CviKI_1 RGCY 7 cut(s) 38, 56, 137, 194, 269, 288, 317
DdeI CTNAG 1 cut(s) 275
Eam1104I CTCTTC 1 cut(s) 276
EarI CTCTTC 1 cut(s) 276
Eco130I CCWWGG 1 cut(s) 60
EcoRII CCWGG 1 cut(s) 264
EcoT14I CCWWGG 1 cut(s) 60
EcoT22I ATGCAT 1 cut(s) 212
ErhI CCWWGG 1 cut(s) 60
FaeI CATG 1 cut(s) 99
FaiI YATR 1 cut(s) 97
FatI CATG 1 cut(s) 95
FauI CCCGC 1 cut(s) 162
Fnu4HI GCNGC 3 cut(s) 36, 57, 195
Fsp4HI GCNGC 3 cut(s) 36, 57, 195
GluI GCNGC 3 cut(s) 36, 57, 195
HaeIII GGCC 1 cut(s) 288
Hin1II CATG 1 cut(s) 99
HindIII AAGCTT 1 cut(s) 315
HinfI GANTC 1 cut(s) 219
Hpy166II GTNNAC 2 cut(s) 182, 250
Hpy188I TCNGA 2 cut(s) 204, 276
Hpy188III TCNNGA 1 cut(s) 119
Hpy8I GTNNAC 2 cut(s) 182, 250
HpyCH4III ACNGT 1 cut(s) 25
HpyCH4V TGCA 4 cut(s) 35, 44, 210, 216
HpyF10VI GCNNNNNNNGC 3 cut(s) 41, 285, 314
HpyF3I CTNAG 1 cut(s) 275
Hsp92II CATG 1 cut(s) 99
LguI GCTCTTC 1 cut(s) 276
LpnPI CCDG 7 cut(s) 31, 104, 147, 251, 278, 302, 318
Lsp1109I GCAGC 1 cut(s) 47
LweI GCATC 1 cut(s) 219
MaeIII GTNAC 1 cut(s) 98
MboII GAAGA 2 cut(s) 86, 263
MluCI AATT 2 cut(s) 29, 141
MnlI CCTC 3 cut(s) 197, 312, 315
Mph1103I ATGCAT 1 cut(s) 212
MspR9I CCNGG 1 cut(s) 266
MvaI CCWGG 1 cut(s) 266
MwoI GCNNNNNNNGC 3 cut(s) 41, 285, 314
NlaIII CATG 1 cut(s) 99
NsiI ATGCAT 1 cut(s) 212
NspI RCATGY 1 cut(s) 99
PciSI GCTCTTC 1 cut(s) 276
PfeI GAWTC 1 cut(s) 219
PkrI GCNGC 3 cut(s) 37, 58, 196
Psp6I CCWGG 1 cut(s) 264
PspGI CCWGG 1 cut(s) 264
PstI CTGCAG 1 cut(s) 218
SapI GCTCTTC 1 cut(s) 276
SatI GCNGC 3 cut(s) 36, 57, 195
ScrFI CCNGG 1 cut(s) 266
SetI ASST 3 cut(s) 40, 82, 319
SfaNI GCATC 1 cut(s) 219
SfcI CTRYAG 1 cut(s) 214
Sse9I AATT 2 cut(s) 29, 141
SsiI CCGC 5 cut(s) 57, 93, 155, 195, 245
StyD4I CCNGG 1 cut(s) 264
StyI CCWWGG 1 cut(s) 60
TaaI ACNGT 1 cut(s) 25
TasI AATT 2 cut(s) 29, 141
TauI GCSGC 2 cut(s) 59, 197
TfiI GAWTC 1 cut(s) 219
TseI GCWGC 1 cut(s) 35
XapI RAATTY 1 cut(s) 29
XceI RCATGY 1 cut(s) 99
Zsp2I ATGCAT 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.