AT5G58790

mRNA-containing ribonucleoprotein complex export from nucleus

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Forward (+)
23744730 .. 23745981
1252 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G58790.3

Sequence Viewer

Length: 69 bp
ATGAAGATCAGAGAAGTACTAATCTTGCTGTTGATAATATCAATGGAGCTAAGGTGTTGGGAAGGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

22

Amino Acids

2.66

Weight (kDa)

5.98

Isoelectric Point (pI)

33.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 18
AluBI AGCT 1 cut(s) 49
AluI AGCT 1 cut(s) 49
BmcAI AGTACT 1 cut(s) 18
Bpu10I CCTNAGC 1 cut(s) 50
BsaXI ACNNNNNCTCC 2 cut(s) 38, 68
Bsp143I GATC 1 cut(s) 6
BssMI GATC 1 cut(s) 6
BstDEI CTNAG 1 cut(s) 50
BstKTI GATC 1 cut(s) 9
BstMBI GATC 1 cut(s) 6
Csp6I GTAC 1 cut(s) 17
CviJI RGCY 1 cut(s) 49
CviKI_1 RGCY 1 cut(s) 49
CviQI GTAC 1 cut(s) 17
DdeI CTNAG 1 cut(s) 50
DpnI GATC 1 cut(s) 8
DpnII GATC 1 cut(s) 6
FspEI CC 5 cut(s) 29, 37, 43, 44, 48
Hpy188I TCNGA 1 cut(s) 11
HpyAV CCTTC 1 cut(s) 56
HpyF3I CTNAG 1 cut(s) 50
Kzo9I GATC 1 cut(s) 6
LmnI GCTCC 1 cut(s) 46
MalI GATC 1 cut(s) 8
MboI GATC 1 cut(s) 6
MboII GAAGA 1 cut(s) 16
MspJI CNNR 7 cut(s) 22, 32, 37, 37, 44, 45, 62
NdeII GATC 1 cut(s) 6
RsaI GTAC 1 cut(s) 18
RsaNI GTAC 1 cut(s) 17
Sau3AI GATC 1 cut(s) 6
ScaI AGTACT 1 cut(s) 18
SetI ASST 2 cut(s) 51, 56
SgeI CNNG 1 cut(s) 37
TatI WGTACW 1 cut(s) 16
TspDTI ATGAA 1 cut(s) 17
ZrmI AGTACT 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.