FvH4_1g18141

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
Physical Location & Seq
Forward (+)
10552387 .. 10557654
5268 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g18141.t1

Sequence Viewer

Length: 546 bp
ATGTCCAATGATGATATCCCTCCACCGAAATCAAGCGGTGATAATCCTCCTCCACCGAAATCAGGCGGTGATCCTCCTCCACCAAAACCAAACAGTTCCGGTTCAGATGCCGATCCCTTCAAGGCAGAACCTTCCAATCCTTACTTCATCCACCACTCGGATCATCCTGGCTTAGTCCTAGTCTCCAAACTCCTAAATGGGGATAATTTTTCTGGTTGGAAAAGGGCTATGTCTCTGGATTCAAGGAGTTGCCCCAGTCTCTGCTATTGCGGAGGCTTACCGGCTGCGGTTGAGGTTGAGCAGCCTAAGGCCACTAGGAGTAGTGCTGCTTCACAAAACATCACTACAAGCTGTGGGAATACTGTTCCGATGTGCAAAAAGCTCGACGATTTAGGTGGCTGGCTCGTCGACAACGTGATGTCAGCCTTCTTTGGTTCTCTGCAACGCTGCTCTTGCATGCACATCGACACCAAAGACGACCCTGATCACGATCCTATTTGCATGCCTCTTGCTACTGCCAACAACAAAGATATTGATATTAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

182

Amino Acids

19.24

Weight (kDa)

5.02

Isoelectric Point (pI)

68.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotran_gag_3 PF14244 51 - 79 4.7e-11 gag-polypeptide of LTR copia-type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017966)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18110 FvH4_1g18141
prunus_persica Prupe.6G217400_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0108601
rosa_laevigata RLG00000017680
rosa_roxburghii Rroxscaffold_2G00134990
rosa_samantha Rh2AG203600 Rh2BG216400 Rh2CG207500 Rh2DG210600
rosa_wichuraiana Rw2G016270

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 408
AciI CCGC 4 cut(s) 36, 66, 270, 287
AclWI GGATC 4 cut(s) 65, 107, 168, 485
AfiI CCNNNNNNNGG 3 cut(s) 62, 157, 199
AgsI TTSAA 2 cut(s) 121, 243
AjnI CCWGG 1 cut(s) 166
AjuI GAANNNNNNNTTGG 2 cut(s) 128, 160
AluBI AGCT 2 cut(s) 351, 382
AluI AGCT 2 cut(s) 351, 382
Alw26I GTCTC 3 cut(s) 187, 237, 263
AlwI GGATC 4 cut(s) 65, 107, 168, 485
AlwNI CAGNNNCTG 1 cut(s) 261
AoxI GGCC 1 cut(s) 309
ApeKI GCWGC 4 cut(s) 284, 301, 326, 447
AseI ATTAAT 1 cut(s) 540
AsuHPI GGTGA 2 cut(s) 50, 80
AxyI CCTNAGG 1 cut(s) 306
BarI GAAGNNNNNNTAC 2 cut(s) 313, 345
BbvI GCAGC 4 cut(s) 271, 313, 313, 434
BcgI CGANNNNNNTGC 4 cut(s) 364, 398, 445, 479
BciT130I CCWGG 1 cut(s) 168
BclI TGATCA 1 cut(s) 484
BcoDI GTCTC 3 cut(s) 187, 237, 263
BfaI CTAG 2 cut(s) 179, 315
BisI GCNGC 4 cut(s) 285, 302, 327, 448
BlsI GCNGC 4 cut(s) 286, 303, 328, 449
Bme1390I CCNGG 1 cut(s) 168
BmrFI CCNGG 1 cut(s) 168
BmrI ACTGGG 1 cut(s) 249
BmsI GCATC 1 cut(s) 97
BmuI ACTGGG 1 cut(s) 249
BsaBI GATNNNNATC 2 cut(s) 111, 489
BsaWI WCCGGW 1 cut(s) 98
Bsc4I CCNNNNNNNGG 3 cut(s) 62, 157, 199
Bse118I RCCGGY 1 cut(s) 280
Bse1I ACTGG 1 cut(s) 255
Bse21I CCTNAGG 1 cut(s) 306
Bse8I GATNNNNATC 2 cut(s) 111, 489
BseBI CCWGG 1 cut(s) 168
BseGI GGATG 2 cut(s) 147, 163
BseJI GATNNNNATC 2 cut(s) 111, 489
BseLI CCNNNNNNNGG 3 cut(s) 62, 157, 199
BseNI ACTGG 1 cut(s) 255
BseRI GAGGAG 2 cut(s) 39, 66
BseXI GCAGC 4 cut(s) 271, 313, 313, 434
BshFI GGCC 1 cut(s) 311
BsiSI CCGG 2 cut(s) 99, 281
BslI CCNNNNNNNGG 3 cut(s) 62, 157, 199
BsmAI GTCTC 3 cut(s) 187, 237, 263
BsnI GGCC 1 cut(s) 311
Bsp143I GATC 5 cut(s) 70, 112, 160, 484, 490
BspACI CCGC 4 cut(s) 36, 66, 270, 287
BspANI GGCC 1 cut(s) 311
BspPI GGATC 4 cut(s) 65, 107, 168, 485
BsrFI RCCGGY 1 cut(s) 280
BsrI ACTGG 1 cut(s) 255
BssAI RCCGGY 1 cut(s) 280
BssMI GATC 5 cut(s) 70, 112, 160, 484, 490
Bst2UI CCWGG 1 cut(s) 168
Bst4CI ACNGT 2 cut(s) 95, 364
BstC8I GCNNGC 3 cut(s) 401, 458, 503
BstDEI CTNAG 2 cut(s) 172, 306
BstF5I GGATG 2 cut(s) 147, 163
BstKTI GATC 5 cut(s) 73, 115, 163, 487, 493
BstMAI GTCTC 3 cut(s) 187, 237, 263
BstMBI GATC 5 cut(s) 70, 112, 160, 484, 490
BstMWI GCNNNNNNNGC 1 cut(s) 453
BstNI CCWGG 1 cut(s) 168
BstNSI RCATGY 2 cut(s) 460, 505
BstSCI CCNGG 1 cut(s) 166
BstV1I GCAGC 4 cut(s) 271, 313, 313, 434
Bsu36I CCTNAGG 1 cut(s) 306
BsuRI GGCC 1 cut(s) 311
BtsCI GGATG 2 cut(s) 147, 163
Cac8I GCNNGC 3 cut(s) 401, 458, 503
CaiI CAGNNNCTG 1 cut(s) 261
Cfr10I RCCGGY 1 cut(s) 280
CviAII CATG 2 cut(s) 457, 502
DdeI CTNAG 2 cut(s) 172, 306
DpnI GATC 5 cut(s) 72, 114, 162, 486, 492
DpnII GATC 5 cut(s) 70, 112, 160, 484, 490
Eco32I GATATC 1 cut(s) 16
Eco81I CCTNAGG 1 cut(s) 306
EcoRII CCWGG 1 cut(s) 166
EcoRV GATATC 1 cut(s) 16
FaeI CATG 2 cut(s) 460, 505
FaiI YATR 3 cut(s) 230, 458, 503
FatI CATG 2 cut(s) 456, 501
FbaI TGATCA 1 cut(s) 484
FblI GTMKAC 1 cut(s) 408
Fnu4HI GCNGC 4 cut(s) 285, 302, 327, 448
FokI GGATG 2 cut(s) 134, 150
Fsp4HI GCNGC 4 cut(s) 285, 302, 327, 448
FspBI CTAG 2 cut(s) 179, 315
GluI GCNGC 4 cut(s) 285, 302, 327, 448
HaeIII GGCC 1 cut(s) 311
HapII CCGG 2 cut(s) 99, 281
Hin1II CATG 2 cut(s) 460, 505
HincII GTYRAC 1 cut(s) 409
HindII GTYRAC 1 cut(s) 409
HinfI GANTC 1 cut(s) 239
HpaII CCGG 2 cut(s) 99, 281
HphI GGTGA 2 cut(s) 50, 80
Hpy166II GTNNAC 1 cut(s) 409
Hpy188I TCNGA 3 cut(s) 106, 160, 369
Hpy188III TCNNGA 2 cut(s) 236, 488
Hpy8I GTNNAC 1 cut(s) 409
Hpy99I CGWCG 2 cut(s) 389, 410
HpyAV CCTTC 3 cut(s) 127, 141, 436
HpyCH4III ACNGT 2 cut(s) 95, 364
HpyCH4IV ACGT 1 cut(s) 414
HpyCH4V TGCA 5 cut(s) 375, 442, 456, 460, 501
HpyF10VI GCNNNNNNNGC 1 cut(s) 453
HpyF3I CTNAG 2 cut(s) 172, 306
HpySE526I ACGT 1 cut(s) 414
Hsp92II CATG 2 cut(s) 460, 505
Ksp22I TGATCA 1 cut(s) 484
Kzo9I GATC 5 cut(s) 70, 112, 160, 484, 490
Lsp1109I GCAGC 4 cut(s) 271, 313, 313, 434
LweI GCATC 1 cut(s) 97
MaeI CTAG 2 cut(s) 179, 315
MaeII ACGT 1 cut(s) 414
MalI GATC 5 cut(s) 72, 114, 162, 486, 492
MboI GATC 5 cut(s) 70, 112, 160, 484, 490
MluCI AATT 2 cut(s) 205, 541
MmeI TCCRAC 1 cut(s) 197
MnlI CCTC 8 cut(s) 30, 57, 60, 84, 87, 266, 286, 516
MseI TTAA 1 cut(s) 540
MspI CCGG 2 cut(s) 99, 281
MspR9I CCNGG 1 cut(s) 168
MvaI CCWGG 1 cut(s) 168
MwoI GCNNNNNNNGC 1 cut(s) 453
NdeII GATC 5 cut(s) 70, 112, 160, 484, 490
NlaIII CATG 2 cut(s) 460, 505
NspI RCATGY 2 cut(s) 460, 505
PaeI GCATGC 2 cut(s) 460, 505
PcsI WCGNNNNNNNCGW 1 cut(s) 411
PfeI GAWTC 1 cut(s) 239
PkrI GCNGC 4 cut(s) 286, 303, 328, 449
PshBI ATTAAT 1 cut(s) 540
Psp6I CCWGG 1 cut(s) 166
PspGI CCWGG 1 cut(s) 166
PstNI CAGNNNCTG 1 cut(s) 261
SalI GTCGAC 1 cut(s) 407
SaqAI TTAA 1 cut(s) 540
SatI GCNGC 4 cut(s) 285, 302, 327, 448
Sau3AI GATC 5 cut(s) 70, 112, 160, 484, 490
ScrFI CCNGG 1 cut(s) 168
SetI ASST 6 cut(s) 133, 297, 353, 384, 397, 417
SfaNI GCATC 1 cut(s) 97
SphI GCATGC 2 cut(s) 460, 505
Sse9I AATT 2 cut(s) 205, 541
SsiI CCGC 4 cut(s) 36, 66, 270, 287
SspMI CTAG 2 cut(s) 179, 315
StyD4I CCNGG 1 cut(s) 166
TaaI ACNGT 2 cut(s) 95, 364
TaiI ACGT 1 cut(s) 417
TaqI TCGA 3 cut(s) 384, 408, 465
TasI AATT 2 cut(s) 205, 541
TfiI GAWTC 1 cut(s) 239
Tru1I TTAA 1 cut(s) 540
Tru9I TTAA 1 cut(s) 540
TseI GCWGC 4 cut(s) 284, 301, 326, 447
TspDTI ATGAA 1 cut(s) 136
VspI ATTAAT 1 cut(s) 540
XceI RCATGY 2 cut(s) 460, 505
XmiI GTMKAC 1 cut(s) 408
XspI CTAG 2 cut(s) 179, 315
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.