FvH4_3g00710

yippee-like protein

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Reverse (-)
341656 .. 343510
1855 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g00710.t3

Sequence Viewer

Length: 330 bp
ATGGGAAGGCTATTCATAGAAACACTGAGCGGCATAAAGATCTTCAAATGCAGATGTTGCAAGGTGGACACTGCCTCCCACAGCGAAATCGTTTCCAAGGACTTTCAGGGCCGTTACGGCAGAGCTTATCTCTTCAGAAACGTGGTGAATATATGTCTTGGGCCTATTGAAGAGCGGAATTTGATTAGTGGATTGCATATTGTGAATGATATTTACTGCAGTTCTTGCCAACAAATTCTGGGTTGGAAATATGCTTATGAACCAGGCGAGAAGTATAAAGAAGGAATGTACATCCTAGAGAAGGAACGACTGATGAAGGAAGGGTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

12.68

Weight (kDa)

8.53

Isoelectric Point (pI)

41.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Yippee-Mis18 PF03226 14 - 87 1.9e-07 Yippee zinc-binding/DNA-binding /Mis18, centromere assembly
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013629)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 2 cut(s) 30, 175
AciI CCGC 2 cut(s) 30, 175
AcsI RAATTY 2 cut(s) 178, 234
AcuI CTGAAG 1 cut(s) 118
AfaI GTAC 1 cut(s) 290
AfiI CCNNNNNNNGG 1 cut(s) 301
AgsI TTSAA 2 cut(s) 46, 170
AjnI CCWGG 1 cut(s) 262
AluBI AGCT 1 cut(s) 125
AluI AGCT 1 cut(s) 125
AoxI GGCC 2 cut(s) 109, 161
ApoI RAATTY 2 cut(s) 178, 234
AspS9I GGNCC 2 cut(s) 109, 161
AsuHPI GGTGA 1 cut(s) 157
BceAI ACGGC 2 cut(s) 96, 133
BciT130I CCWGG 1 cut(s) 264
BfaI CTAG 1 cut(s) 296
BfmI CTRYAG 1 cut(s) 217
BglI GCCNNNNNGGC 1 cut(s) 117
BglII AGATCT 1 cut(s) 39
BisI GCNGC 1 cut(s) 31
BlsI GCNGC 1 cut(s) 32
Bme1390I CCNGG 1 cut(s) 264
BmgT120I GGNCC 2 cut(s) 109, 161
BmrFI CCNGG 1 cut(s) 264
BplI GAGNNNNNCTC 2 cut(s) 114, 146
BsaJI CCNNGG 1 cut(s) 96
BsaXI ACNNNNNCTCC 2 cut(s) 59, 89
Bsc4I CCNNNNNNNGG 1 cut(s) 301
BseBI CCWGG 1 cut(s) 264
BseDI CCNNGG 1 cut(s) 96
BseGI GGATG 1 cut(s) 291
BseLI CCNNNNNNNGG 1 cut(s) 301
BseMII CTCAG 1 cut(s) 17
BshFI GGCC 2 cut(s) 111, 163
BslI CCNNNNNNNGG 1 cut(s) 301
BsnI GGCC 2 cut(s) 111, 163
Bsp1407I TGTACA 1 cut(s) 288
Bsp143I GATC 1 cut(s) 39
BspACI CCGC 2 cut(s) 30, 175
BspANI GGCC 2 cut(s) 111, 163
BspCNI CTCAG 1 cut(s) 18
BspMAI CTGCAG 1 cut(s) 221
BspQI GCTCTTC 1 cut(s) 165
BsrBI CCGCTC 2 cut(s) 30, 175
BsrGI TGTACA 1 cut(s) 288
BssECI CCNNGG 1 cut(s) 96
BssMI GATC 1 cut(s) 39
BssT1I CCWWGG 1 cut(s) 96
Bst2UI CCWGG 1 cut(s) 264
Bst6I CTCTTC 2 cut(s) 137, 165
BstAPI GCANNNNNTGC 2 cut(s) 57, 225
BstAUI TGTACA 1 cut(s) 288
BstDEI CTNAG 1 cut(s) 26
BstENI CCTNNNNNAGG 1 cut(s) 299
BstF5I GGATG 1 cut(s) 291
BstKTI GATC 1 cut(s) 42
BstMBI GATC 1 cut(s) 39
BstMWI GCNNNNNNNGC 3 cut(s) 57, 117, 225
BstNI CCWGG 1 cut(s) 264
BstSCI CCNGG 1 cut(s) 262
BstSFI CTRYAG 1 cut(s) 217
BstX2I RGATCY 1 cut(s) 39
BstYI RGATCY 1 cut(s) 39
BsuRI GGCC 2 cut(s) 111, 163
BtsCI GGATG 1 cut(s) 291
BtsI GCAGTG 1 cut(s) 69
BtsIMutI CAGTG 2 cut(s) 23, 69
Cfr13I GGNCC 2 cut(s) 109, 161
Csp6I GTAC 1 cut(s) 289
CviJI RGCY 4 cut(s) 10, 111, 125, 163
CviKI_1 RGCY 4 cut(s) 10, 111, 125, 163
CviQI GTAC 1 cut(s) 289
DdeI CTNAG 1 cut(s) 26
DpnI GATC 1 cut(s) 41
DpnII GATC 1 cut(s) 39
Eam1104I CTCTTC 2 cut(s) 137, 165
EarI CTCTTC 2 cut(s) 137, 165
Eco130I CCWWGG 1 cut(s) 96
Eco57I CTGAAG 1 cut(s) 118
EcoNI CCTNNNNNAGG 1 cut(s) 299
EcoRII CCWGG 1 cut(s) 262
EcoT14I CCWWGG 1 cut(s) 96
ErhI CCWWGG 1 cut(s) 96
FaiI YATR 8 cut(s) 17, 35, 152, 154, 198, 252, 258, 276
Fnu4HI GCNGC 1 cut(s) 31
FokI GGATG 1 cut(s) 278
Fsp4HI GCNGC 1 cut(s) 31
FspBI CTAG 1 cut(s) 296
GluI GCNGC 1 cut(s) 31
HaeIII GGCC 2 cut(s) 111, 163
HphI GGTGA 1 cut(s) 157
Hpy166II GTNNAC 1 cut(s) 67
Hpy188I TCNGA 1 cut(s) 137
Hpy8I GTNNAC 1 cut(s) 67
HpyAV CCTTC 4 cut(s) 275, 295, 310, 314
HpyCH4IV ACGT 1 cut(s) 141
HpyCH4V TGCA 4 cut(s) 51, 60, 196, 219
HpyF10VI GCNNNNNNNGC 3 cut(s) 57, 117, 225
HpyF3I CTNAG 1 cut(s) 26
HpySE526I ACGT 1 cut(s) 141
Kzo9I GATC 1 cut(s) 39
LguI GCTCTTC 1 cut(s) 165
LpnPI CCDG 4 cut(s) 92, 224, 249, 276
MaeI CTAG 1 cut(s) 296
MaeII ACGT 1 cut(s) 141
MaeIII GTNAC 1 cut(s) 113
MalI GATC 1 cut(s) 41
MbiI CCGCTC 2 cut(s) 30, 175
MboI GATC 1 cut(s) 39
MboII GAAGA 3 cut(s) 34, 124, 182
MflI RGATCY 1 cut(s) 39
MluCI AATT 2 cut(s) 178, 234
MmeI TCCRAC 1 cut(s) 224
MnlI CCTC 1 cut(s) 85
MspR9I CCNGG 1 cut(s) 264
MvaI CCWGG 1 cut(s) 264
MwoI GCNNNNNNNGC 3 cut(s) 57, 117, 225
NdeII GATC 1 cut(s) 39
PciSI GCTCTTC 1 cut(s) 165
PkrI GCNGC 1 cut(s) 32
Psp6I CCWGG 1 cut(s) 262
PspGI CCWGG 1 cut(s) 262
PspPI GGNCC 2 cut(s) 109, 161
PstI CTGCAG 1 cut(s) 221
PsuI RGATCY 1 cut(s) 39
RsaI GTAC 1 cut(s) 290
RsaNI GTAC 1 cut(s) 289
SapI GCTCTTC 1 cut(s) 165
SatI GCNGC 1 cut(s) 31
Sau3AI GATC 1 cut(s) 39
Sau96I GGNCC 2 cut(s) 109, 161
ScrFI CCNGG 1 cut(s) 264
SetI ASST 3 cut(s) 66, 127, 144
SfcI CTRYAG 1 cut(s) 217
Sse9I AATT 2 cut(s) 178, 234
SsiI CCGC 2 cut(s) 30, 175
SspMI CTAG 1 cut(s) 296
StyD4I CCNGG 1 cut(s) 262
StyI CCWWGG 1 cut(s) 96
TaiI ACGT 1 cut(s) 144
TasI AATT 2 cut(s) 178, 234
TatI WGTACW 1 cut(s) 288
TauI GCSGC 1 cut(s) 33
TscAI CASTG 2 cut(s) 30, 76
TspDTI ATGAA 3 cut(s) 4, 273, 329
TspRI CASTG 2 cut(s) 30, 76
XagI CCTNNNNNAGG 1 cut(s) 299
XapI RAATTY 2 cut(s) 178, 234
XspI CTAG 1 cut(s) 296
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.