FvH4_4g08000

RuBisCO catalyzes two reactions the carboxylation of D- ribulose 1,5-bisphosphate, the primary event in carbon dioxide fixation, as well as the oxidative fragmentation of the pentose substrate. Both reactions occur simultaneously and in competition at the same active site

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
Physical Location & Seq
Reverse (-)
7579651 .. 7581187
1537 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g08000.t2

Sequence Viewer

Length: 573 bp
ATGTTTCTTTACAAATCACACTGTGCTGTGTTCTTTGTTAAACAGAAGATGTCTGCTTCTATCTTCAAATCTCCTGTTCCTGCATCTGGTTACGTTGGCTTAGCAACCAGCCCTTCCAAAATTTTCCCAGCTAAAGACTCTATCGGATGGACCAAGAAAACTGTCTCCAATTGTTCAAGAACTTGCTGCATGAAGTCATGGAATCCGATCAACAACAAGAAGTTTGAAACTTTGTCTTACCTCCCACCACTCTCTGATGATTCAATTGCAAAGGAGATTGACTACATGCTCAAGAAGGGGTGGATCCCTTGCCTTGAATTTGACGAGGTGGGATATGTTCAAAGGGAGAATAGCAGGATGCCAGGGTACTATGATGGAAGATATTGGACGTTGTGGAAGCTACCCATGTTTGGTTGCATTGACCCTTCTCTGGTGCTCAATGAAATCCAAGAGTGCAAGAAAACGTACCCAAATGCTTATATACGTTGTGTAGCATTTGACAACCAGAACCAGGGTCAGTGCATGGCCTTTATCATTCAGAAGCCAAACATTGCAGCCACCACCAGTGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

191

Amino Acids

21.61

Weight (kDa)

9.0

Isoelectric Point (pI)

48.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RuBisCO_small PF00101 59 - 166 3.1e-38 Ribulose bisphosphate carboxylase, small chain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014712)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 298, 311
AcsI RAATTY 2 cut(s) 120, 317
AdeI CACNNNGTG 1 cut(s) 23
AfaI GTAC 2 cut(s) 368, 467
AfiI CCNNNNNNNGG 4 cut(s) 86, 410, 430, 511
AgsI TTSAA 6 cut(s) 67, 177, 227, 264, 317, 341
AjnI CCWGG 2 cut(s) 361, 510
AluBI AGCT 2 cut(s) 131, 400
AluI AGCT 2 cut(s) 131, 400
Alw21I GWGCWC 1 cut(s) 438
Alw26I GTCTC 1 cut(s) 169
AlwI GGATC 2 cut(s) 298, 311
AoxI GGCC 1 cut(s) 525
ApeKI GCWGC 2 cut(s) 186, 554
ApoI RAATTY 2 cut(s) 120, 317
AspS9I GGNCC 1 cut(s) 150
AvaII GGWCC 1 cut(s) 150
BamHI GGATCC 1 cut(s) 303
Bbv12I GWGCWC 1 cut(s) 438
BbvI GCAGC 2 cut(s) 173, 566
BccI CCATC 2 cut(s) 141, 368
BciT130I CCWGG 2 cut(s) 363, 512
BcoDI GTCTC 1 cut(s) 169
BisI GCNGC 2 cut(s) 187, 555
BlpI GCTNAGC 1 cut(s) 100
BlsI GCNGC 2 cut(s) 188, 556
Bme1390I CCNGG 2 cut(s) 363, 512
Bme18I GGWCC 1 cut(s) 150
BmgT120I GGNCC 1 cut(s) 150
BmiI GGNNCC 1 cut(s) 305
BmrFI CCNGG 2 cut(s) 363, 512
BmsI GCATC 2 cut(s) 92, 348
Bpu1102I GCTNAGC 1 cut(s) 100
BpuEI CTTGAG 1 cut(s) 275
BsaJI CCNNGG 2 cut(s) 362, 511
Bsc4I CCNNNNNNNGG 4 cut(s) 86, 410, 430, 511
Bse1I ACTGG 1 cut(s) 564
Bse3DI GCAATG 1 cut(s) 549
BseBI CCWGG 2 cut(s) 363, 512
BseDI CCNNGG 2 cut(s) 362, 511
BseGI GGATG 2 cut(s) 152, 363
BseLI CCNNNNNNNGG 4 cut(s) 86, 410, 430, 511
BseMI GCAATG 1 cut(s) 549
BseNI ACTGG 1 cut(s) 564
BseXI GCAGC 2 cut(s) 173, 566
BseYI CCCAGC 1 cut(s) 127
BshFI GGCC 1 cut(s) 527
BsiHKAI GWGCWC 1 cut(s) 438
BslI CCNNNNNNNGG 4 cut(s) 86, 410, 430, 511
BsmAI GTCTC 1 cut(s) 169
BsnI GGCC 1 cut(s) 527
Bsp1286I GDGCHC 1 cut(s) 438
Bsp143I GATC 2 cut(s) 207, 303
Bsp1720I GCTNAGC 1 cut(s) 100
BspANI GGCC 1 cut(s) 527
BspLI GGNNCC 1 cut(s) 305
BspPI GGATC 2 cut(s) 298, 311
BsrDI GCAATG 1 cut(s) 549
BsrI ACTGG 1 cut(s) 564
BssECI CCNNGG 2 cut(s) 362, 511
BssMI GATC 2 cut(s) 207, 303
Bst2UI CCWGG 2 cut(s) 363, 512
Bst4CI ACNGT 2 cut(s) 23, 163
BstDEI CTNAG 1 cut(s) 100
BstF5I GGATG 2 cut(s) 152, 363
BstKTI GATC 2 cut(s) 210, 306
BstMAI GTCTC 1 cut(s) 169
BstMBI GATC 2 cut(s) 207, 303
BstNI CCWGG 2 cut(s) 363, 512
BstNSI RCATGY 1 cut(s) 289
BstSCI CCNGG 2 cut(s) 361, 510
BstV1I GCAGC 2 cut(s) 173, 566
BstX2I RGATCY 1 cut(s) 303
BstYI RGATCY 1 cut(s) 303
BsuRI GGCC 1 cut(s) 527
BtsCI GGATG 2 cut(s) 152, 363
BtsIMutI CAGTG 3 cut(s) 19, 524, 571
Cfr13I GGNCC 1 cut(s) 150
Csp6I GTAC 2 cut(s) 367, 466
CviAII CATG 5 cut(s) 190, 198, 286, 406, 523
CviJI RGCY 7 cut(s) 99, 111, 131, 400, 527, 544, 557
CviKI_1 RGCY 7 cut(s) 99, 111, 131, 400, 527, 544, 557
CviQI GTAC 2 cut(s) 367, 466
DdeI CTNAG 1 cut(s) 100
DpnI GATC 2 cut(s) 209, 305
DpnII GATC 2 cut(s) 207, 303
DraIII CACNNNGTG 1 cut(s) 23
Eco47I GGWCC 1 cut(s) 150
EcoRII CCWGG 2 cut(s) 361, 510
FaeI CATG 5 cut(s) 193, 201, 289, 409, 526
FaiI YATR 9 cut(s) 191, 199, 287, 336, 372, 407, 480, 482, 524
FatI CATG 5 cut(s) 189, 197, 285, 405, 522
Fnu4HI GCNGC 2 cut(s) 187, 555
FokI GGATG 2 cut(s) 159, 370
Fsp4HI GCNGC 2 cut(s) 187, 555
GluI GCNGC 2 cut(s) 187, 555
GsaI CCCAGC 1 cut(s) 131
HaeIII GGCC 1 cut(s) 527
Hin1II CATG 5 cut(s) 193, 201, 289, 409, 526
HinfI GANTC 3 cut(s) 137, 202, 260
Hpy188I TCNGA 4 cut(s) 146, 207, 256, 540
Hpy188III TCNNGA 2 cut(s) 177, 292
HpyAV CCTTC 3 cut(s) 123, 289, 435
HpyCH4III ACNGT 2 cut(s) 23, 163
HpyCH4IV ACGT 4 cut(s) 93, 389, 464, 484
HpyCH4V TGCA 7 cut(s) 83, 189, 269, 417, 456, 522, 554
HpyF3I CTNAG 1 cut(s) 100
HpySE526I ACGT 4 cut(s) 93, 389, 464, 484
Hsp92II CATG 5 cut(s) 193, 201, 289, 409, 526
Kzo9I GATC 2 cut(s) 207, 303
Lsp1109I GCAGC 2 cut(s) 173, 566
LweI GCATC 2 cut(s) 92, 348
MaeII ACGT 4 cut(s) 93, 389, 464, 484
MaeIII GTNAC 1 cut(s) 89
MalI GATC 2 cut(s) 209, 305
MboI GATC 2 cut(s) 207, 303
MboII GAAGA 3 cut(s) 55, 58, 390
MfeI CAATTG 2 cut(s) 169, 264
MflI RGATCY 1 cut(s) 303
MhlI GDGCHC 1 cut(s) 438
MluCI AATT 4 cut(s) 120, 169, 264, 317
MlyI GAGTC 1 cut(s) 131
MnlI CCTC 2 cut(s) 251, 319
MseI TTAA 1 cut(s) 39
MspR9I CCNGG 2 cut(s) 363, 512
MunI CAATTG 2 cut(s) 169, 264
MvaI CCWGG 2 cut(s) 363, 512
NdeII GATC 2 cut(s) 207, 303
NlaIII CATG 5 cut(s) 193, 201, 289, 409, 526
NlaIV GGNNCC 1 cut(s) 305
NspI RCATGY 1 cut(s) 289
PfeI GAWTC 2 cut(s) 202, 260
PkrI GCNGC 2 cut(s) 188, 556
PleI GAGTC 1 cut(s) 131
PpsI GAGTC 1 cut(s) 131
Psp6I CCWGG 2 cut(s) 361, 510
PspFI CCCAGC 1 cut(s) 127
PspGI CCWGG 2 cut(s) 361, 510
PspN4I GGNNCC 1 cut(s) 305
PspPI GGNCC 1 cut(s) 150
PsuI RGATCY 1 cut(s) 303
RsaI GTAC 2 cut(s) 368, 467
RsaNI GTAC 2 cut(s) 367, 466
SaqAI TTAA 1 cut(s) 39
SatI GCNGC 2 cut(s) 187, 555
Sau3AI GATC 2 cut(s) 207, 303
Sau96I GGNCC 1 cut(s) 150
SchI GAGTC 1 cut(s) 131
ScrFI CCNGG 2 cut(s) 363, 512
SduI GDGCHC 1 cut(s) 438
SetI ASST 8 cut(s) 96, 133, 243, 330, 392, 402, 467, 487
SfaNI GCATC 2 cut(s) 92, 348
SinI GGWCC 1 cut(s) 150
SmlI CTYRAG 1 cut(s) 290
SmoI CTYRAG 1 cut(s) 290
Sse9I AATT 4 cut(s) 120, 169, 264, 317
StyD4I CCNGG 2 cut(s) 361, 510
TaaI ACNGT 2 cut(s) 23, 163
TaiI ACGT 4 cut(s) 96, 392, 467, 487
TasI AATT 4 cut(s) 120, 169, 264, 317
TfiI GAWTC 2 cut(s) 202, 260
Tru1I TTAA 1 cut(s) 39
Tru9I TTAA 1 cut(s) 39
TscAI CASTG 3 cut(s) 26, 524, 571
TseI GCWGC 2 cut(s) 186, 554
TspDTI ATGAA 2 cut(s) 206, 456
TspRI CASTG 3 cut(s) 26, 524, 571
VpaK11BI GGWCC 1 cut(s) 150
XapI RAATTY 2 cut(s) 120, 317
XceI RCATGY 1 cut(s) 289
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.