Rh4AG108600

RuBisCO catalyzes two reactions the carboxylation of D- ribulose 1,5-bisphosphate, the primary event in carbon dioxide fixation, as well as the oxidative fragmentation of the pentose substrate. Both reactions occur simultaneously and in competition at the same active site

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
23612012 .. 23613032
1021 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG108600.1

Sequence Viewer

Length: 525 bp
ATGTCTGCTGCTATCTTCAATTCTCCGGTTGCTGCATCTGGTTACGTTGGCTTAGCAACCAACCCTTCAAAAATTTTCCTAGCTAAAGACTCTATCGGATGGACCAAGAAAACTGTCTCCAATGGTTCAAGAACTTGCTGCATGAAGACGTGGAACCCGATCAACAACAAGAAATTTGAGACTCTGTCTTACCTCCCACCACTCTCTGATGATTCAATTGCAAAGGAGATTGACTACATGCTCAAGAAGGGATGGATCCCTTGCCTTGAATTTGATGAGGTGGGTTATGTTCATAGGGAGAATAGCAGGATGCCAGGGTACTATGATGGAAGATACTGGACATTGTGGAAGCTACCCATGTTTGGTTGTACCGACCCTTCTCTGGTGCTCAATGAAATCCAAGAGTGCAAAAAAACGTACCCAAATGCTTATATACGCTGTTTAGCATTTGACAACCAGAACCAGGGTCAGTGCATGTCCTTTATCATTCAGAAGCCAACCATCGCGGCCACCAACAGTGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

174

Amino Acids

19.64

Weight (kDa)

8.63

Isoelectric Point (pI)

42.67

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RuBisCO_small PF00101 59 - 166 4.5e-39 Ribulose bisphosphate carboxylase, small chain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014712)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 506
AciI CCGC 1 cut(s) 506
AclWI GGATC 2 cut(s) 250, 263
AcoI YGGCCR 1 cut(s) 507
AcsI RAATTY 3 cut(s) 72, 173, 269
AfaI GTAC 3 cut(s) 320, 370, 419
AfiI CCNNNNNNNGG 3 cut(s) 362, 382, 463
AgsI TTSAA 5 cut(s) 19, 69, 129, 216, 269
AjiI CACGTC 1 cut(s) 150
AjnI CCWGG 2 cut(s) 313, 462
AluBI AGCT 2 cut(s) 83, 352
AluI AGCT 2 cut(s) 83, 352
Alw21I GWGCWC 1 cut(s) 390
Alw26I GTCTC 2 cut(s) 121, 173
AlwI GGATC 2 cut(s) 250, 263
AoxI GGCC 1 cut(s) 507
ApeKI GCWGC 3 cut(s) 8, 32, 138
ApoI RAATTY 3 cut(s) 72, 173, 269
AspS9I GGNCC 1 cut(s) 102
AvaII GGWCC 1 cut(s) 102
BamHI GGATCC 1 cut(s) 255
BarI GAAGNNNNNNTAC 2 cut(s) 361, 393
BbsI GAAGAC 1 cut(s) 152
Bbv12I GWGCWC 1 cut(s) 390
BbvI GCAGC 2 cut(s) 19, 125
BccI CCATC 4 cut(s) 93, 246, 320, 509
BciT130I CCWGG 2 cut(s) 315, 464
BcoDI GTCTC 2 cut(s) 121, 173
BfaI CTAG 1 cut(s) 80
BisI GCNGC 4 cut(s) 9, 33, 139, 507
BlpI GCTNAGC 1 cut(s) 52
BlsI GCNGC 4 cut(s) 10, 34, 140, 508
Bme1390I CCNGG 2 cut(s) 315, 464
Bme18I GGWCC 1 cut(s) 102
BmgBI CACGTC 1 cut(s) 150
BmgT120I GGNCC 1 cut(s) 102
BmiI GGNNCC 2 cut(s) 155, 257
BmrFI CCNGG 2 cut(s) 315, 464
BmsI GCATC 2 cut(s) 44, 300
BpiI GAAGAC 1 cut(s) 152
Bpu1102I GCTNAGC 1 cut(s) 52
BpuEI CTTGAG 1 cut(s) 227
BsaJI CCNNGG 2 cut(s) 314, 463
BsaWI WCCGGW 1 cut(s) 25
Bsc4I CCNNNNNNNGG 3 cut(s) 362, 382, 463
Bse1I ACTGG 1 cut(s) 341
BseBI CCWGG 2 cut(s) 315, 464
BseDI CCNNGG 2 cut(s) 314, 463
BseGI GGATG 3 cut(s) 104, 257, 315
BseLI CCNNNNNNNGG 3 cut(s) 362, 382, 463
BseNI ACTGG 1 cut(s) 341
BseXI GCAGC 2 cut(s) 19, 125
Bsh1236I CGCG 1 cut(s) 506
BshFI GGCC 1 cut(s) 509
BsiHKAI GWGCWC 1 cut(s) 390
BsiSI CCGG 1 cut(s) 26
BslI CCNNNNNNNGG 3 cut(s) 362, 382, 463
BsmAI GTCTC 2 cut(s) 121, 173
BsnI GGCC 1 cut(s) 509
Bsp1286I GDGCHC 1 cut(s) 390
Bsp143I GATC 2 cut(s) 159, 255
Bsp1720I GCTNAGC 1 cut(s) 52
BspACI CCGC 1 cut(s) 506
BspANI GGCC 1 cut(s) 509
BspFNI CGCG 1 cut(s) 506
BspLI GGNNCC 2 cut(s) 155, 257
BspPI GGATC 2 cut(s) 250, 263
BsrI ACTGG 1 cut(s) 341
BssECI CCNNGG 2 cut(s) 314, 463
BssMI GATC 2 cut(s) 159, 255
Bst2UI CCWGG 2 cut(s) 315, 464
Bst4CI ACNGT 2 cut(s) 115, 518
BstDEI CTNAG 1 cut(s) 52
BstF5I GGATG 3 cut(s) 104, 257, 315
BstFNI CGCG 1 cut(s) 506
BstKTI GATC 2 cut(s) 162, 258
BstMAI GTCTC 2 cut(s) 121, 173
BstMBI GATC 2 cut(s) 159, 255
BstNI CCWGG 2 cut(s) 315, 464
BstNSI RCATGY 2 cut(s) 241, 478
BstSCI CCNGG 2 cut(s) 313, 462
BstUI CGCG 1 cut(s) 506
BstV1I GCAGC 2 cut(s) 19, 125
BstV2I GAAGAC 1 cut(s) 152
BstX2I RGATCY 1 cut(s) 255
BstYI RGATCY 1 cut(s) 255
BsuRI GGCC 1 cut(s) 509
BtgZI GCGATG 1 cut(s) 487
BtrI CACGTC 1 cut(s) 150
BtsCI GGATG 3 cut(s) 104, 257, 315
BtsIMutI CAGTG 2 cut(s) 476, 523
Cfr13I GGNCC 1 cut(s) 102
Csp6I GTAC 3 cut(s) 319, 369, 418
CviAII CATG 4 cut(s) 142, 238, 358, 475
CviJI RGCY 5 cut(s) 51, 83, 352, 496, 509
CviKI_1 RGCY 5 cut(s) 51, 83, 352, 496, 509
CviQI GTAC 3 cut(s) 319, 369, 418
DdeI CTNAG 1 cut(s) 52
DpnI GATC 2 cut(s) 161, 257
DpnII GATC 2 cut(s) 159, 255
EaeI YGGCCR 1 cut(s) 507
Eco47I GGWCC 1 cut(s) 102
EcoRII CCWGG 2 cut(s) 313, 462
FaeI CATG 4 cut(s) 145, 241, 361, 478
FaiI YATR 9 cut(s) 143, 239, 288, 294, 324, 359, 432, 434, 476
FatI CATG 4 cut(s) 141, 237, 357, 474
Fnu4HI GCNGC 4 cut(s) 9, 33, 139, 507
FokI GGATG 3 cut(s) 111, 264, 322
Fsp4HI GCNGC 4 cut(s) 9, 33, 139, 507
FspBI CTAG 1 cut(s) 80
GluI GCNGC 4 cut(s) 9, 33, 139, 507
HaeIII GGCC 1 cut(s) 509
HapII CCGG 1 cut(s) 26
Hin1II CATG 4 cut(s) 145, 241, 361, 478
HinfI GANTC 3 cut(s) 89, 181, 212
HpaII CCGG 1 cut(s) 26
Hpy188I TCNGA 3 cut(s) 98, 208, 492
Hpy188III TCNNGA 2 cut(s) 129, 244
HpyAV CCTTC 3 cut(s) 75, 241, 387
HpyCH4III ACNGT 2 cut(s) 115, 518
HpyCH4IV ACGT 3 cut(s) 45, 149, 416
HpyCH4V TGCA 5 cut(s) 35, 141, 221, 408, 474
HpyF3I CTNAG 1 cut(s) 52
HpySE526I ACGT 3 cut(s) 45, 149, 416
Hsp92II CATG 4 cut(s) 145, 241, 361, 478
Kzo9I GATC 2 cut(s) 159, 255
Lsp1109I GCAGC 2 cut(s) 19, 125
LweI GCATC 2 cut(s) 44, 300
MaeI CTAG 1 cut(s) 80
MaeII ACGT 3 cut(s) 45, 149, 416
MaeIII GTNAC 1 cut(s) 41
MalI GATC 2 cut(s) 161, 257
MboI GATC 2 cut(s) 159, 255
MboII GAAGA 3 cut(s) 7, 157, 342
MfeI CAATTG 1 cut(s) 216
MflI RGATCY 1 cut(s) 255
MhlI GDGCHC 1 cut(s) 390
MluCI AATT 5 cut(s) 19, 72, 173, 216, 269
MlyI GAGTC 2 cut(s) 83, 175
MnlI CCTC 2 cut(s) 203, 271
MspI CCGG 1 cut(s) 26
MspR9I CCNGG 2 cut(s) 315, 464
MunI CAATTG 1 cut(s) 216
MvaI CCWGG 2 cut(s) 315, 464
MvnI CGCG 1 cut(s) 506
NdeII GATC 2 cut(s) 159, 255
NlaIII CATG 4 cut(s) 145, 241, 361, 478
NlaIV GGNNCC 2 cut(s) 155, 257
NspI RCATGY 2 cut(s) 241, 478
PcsI WCGNNNNNNNCGW 1 cut(s) 155
PfeI GAWTC 1 cut(s) 212
PflFI GACNNNGTC 1 cut(s) 184
PkrI GCNGC 4 cut(s) 10, 34, 140, 508
PleI GAGTC 2 cut(s) 83, 175
PpsI GAGTC 2 cut(s) 83, 175
Psp6I CCWGG 2 cut(s) 313, 462
PspGI CCWGG 2 cut(s) 313, 462
PspN4I GGNNCC 2 cut(s) 155, 257
PspPI GGNCC 1 cut(s) 102
PsuI RGATCY 1 cut(s) 255
PsyI GACNNNGTC 1 cut(s) 184
RsaI GTAC 3 cut(s) 320, 370, 419
RsaNI GTAC 3 cut(s) 319, 369, 418
SatI GCNGC 4 cut(s) 9, 33, 139, 507
Sau3AI GATC 2 cut(s) 159, 255
Sau96I GGNCC 1 cut(s) 102
SchI GAGTC 2 cut(s) 83, 175
ScrFI CCNGG 2 cut(s) 315, 464
SduI GDGCHC 1 cut(s) 390
SetI ASST 7 cut(s) 48, 85, 152, 195, 282, 354, 419
SfaNI GCATC 2 cut(s) 44, 300
SinI GGWCC 1 cut(s) 102
SmlI CTYRAG 1 cut(s) 242
SmoI CTYRAG 1 cut(s) 242
Sse9I AATT 5 cut(s) 19, 72, 173, 216, 269
SsiI CCGC 1 cut(s) 506
SspMI CTAG 1 cut(s) 80
StyD4I CCNGG 2 cut(s) 313, 462
TaaI ACNGT 2 cut(s) 115, 518
TaiI ACGT 3 cut(s) 48, 152, 419
TasI AATT 5 cut(s) 19, 72, 173, 216, 269
TauI GCSGC 1 cut(s) 509
TfiI GAWTC 1 cut(s) 212
TscAI CASTG 2 cut(s) 476, 523
TseI GCWGC 3 cut(s) 8, 32, 138
TspDTI ATGAA 3 cut(s) 158, 281, 408
TspRI CASTG 2 cut(s) 476, 523
Tth111I GACNNNGTC 1 cut(s) 184
VpaK11BI GGWCC 1 cut(s) 102
XapI RAATTY 3 cut(s) 72, 173, 269
XceI RCATGY 2 cut(s) 241, 478
XspI CTAG 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.