Prupe.1G084500_v2.0.a1

RuBisCO catalyzes two reactions the carboxylation of D- ribulose 1,5-bisphosphate, the primary event in carbon dioxide fixation, as well as the oxidative fragmentation of the pentose substrate. Both reactions occur simultaneously and in competition at the same active site

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0014712
Physical Location & Seq
Reverse (-)
6285765 .. 6287153
1389 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G084500.1

Sequence Viewer

Length: 528 bp
ATGTCTTCTGCAATCTTCAATGCTCCGGTTGCTGCATCCGGCTACGTTGGCCTGTCAACCAACCCTCCGAAAATTTTCCCGGTTAAAGATTCGATTGGATGGACCAAGAAAACTGTCTCCAATGGTTCAAGAACTCACTGCATGAAGGTATGGAACCCAATCAACAACAAGAAGTTTGAGACACTGTCCTACCTTCCACCACTCTCTGATGATTCAATTGCAAAGGAGATTGACTACATGCTCAAGAAAGGATGGATCCCTTGCCTCGAATTCGATGAGATCGGGCATATTTACAGGGAGAATAGCACGATGCCAGGCTACTACGATGGGAGATACTGGACATTGTGGAAGCTGCCCATGTTTGGTTGCACTGACCCGTCTCTGGTGCTCAATGAAATCTACCAGTGCAAAACAGCTTACCCAAATGCTTATATACGCTGTATGGCATTTGACAACATCAACCAGGGCCAGTGTATGGCCTTTATCATTCAGAAGCCAGCCGCCGCCACCATCACCACCAACGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00630 ko00710 ko01100 ko01120 ko01200 map00630 map00710 map01100 map01120 map01200
Pfam Domains
Protein Families
RuBisCO_small

Protein Analysis

176

Amino Acids

19.73

Weight (kDa)

8.47

Isoelectric Point (pI)

46.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014712)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g08000 FvH4_4g08000
malus_domestica MD04G1188500.v1.1 MD13G1252300.v1.1
prunus_persica Prupe.1G084500_v2.0.a1
pyrus_communis pycom13g22570
rosa_chinensis RchiOBHm_Chr4g0401741
rosa_laevigata RLG00000009138
rosa_multiflora Rmu_sc0001405.1_g000012 Rmu_sc0012591.1_g000003
rosa_roxburghii Rroxscaffold_5G00346210
rosa_rugosa Rorug04G0031400
rosa_samantha Rh4AG108600 Rh4BG102300 Rh4CG116800 Rh4DG100300
rosa_wichuraiana Rw4G008830

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 475
AciI CCGC 2 cut(s) 501, 504
AclWI GGATC 2 cut(s) 250, 263
AcsI RAATTY 2 cut(s) 72, 269
AfiI CCNNNNNNNGG 3 cut(s) 362, 382, 475
AgsI TTSAA 3 cut(s) 19, 129, 216
AjnI CCWGG 2 cut(s) 313, 462
AluBI AGCT 2 cut(s) 352, 416
AluI AGCT 2 cut(s) 352, 416
Alw21I GWGCWC 1 cut(s) 390
Alw26I GTCTC 3 cut(s) 121, 173, 384
AlwI GGATC 2 cut(s) 250, 263
AoxI GGCC 3 cut(s) 49, 466, 477
ApeKI GCWGC 2 cut(s) 32, 352
ApoI RAATTY 2 cut(s) 72, 269
Asp700I GAANNNNTTC 1 cut(s) 74
AspS9I GGNCC 2 cut(s) 102, 466
AsuC2I CCSGG 1 cut(s) 80
AsuHPI GGTGA 1 cut(s) 505
AvaII GGWCC 1 cut(s) 102
BamHI GGATCC 1 cut(s) 255
Bbv12I GWGCWC 1 cut(s) 390
BbvI GCAGC 2 cut(s) 19, 339
BccI CCATC 4 cut(s) 93, 246, 320, 518
BciT130I CCWGG 2 cut(s) 315, 464
BcnI CCSGG 1 cut(s) 80
BcoDI GTCTC 3 cut(s) 121, 173, 384
BisI GCNGC 4 cut(s) 33, 353, 501, 504
BlsI GCNGC 4 cut(s) 34, 354, 502, 505
Bme1390I CCNGG 3 cut(s) 80, 315, 464
Bme18I GGWCC 1 cut(s) 102
BmgT120I GGNCC 2 cut(s) 102, 466
BmiI GGNNCC 2 cut(s) 155, 257
BmrFI CCNGG 3 cut(s) 80, 315, 464
BmsI GCATC 2 cut(s) 44, 300
BpuEI CTTGAG 1 cut(s) 227
BpuMI CCSGG 1 cut(s) 80
BsaJI CCNNGG 1 cut(s) 463
BsaWI WCCGGW 1 cut(s) 25
BsaXI ACNNNNNCTCC 2 cut(s) 49, 79
Bsc4I CCNNNNNNNGG 3 cut(s) 362, 382, 475
Bse1I ACTGG 3 cut(s) 341, 403, 469
BseBI CCWGG 2 cut(s) 315, 464
BseDI CCNNGG 1 cut(s) 463
BseGI GGATG 3 cut(s) 35, 104, 257
BseLI CCNNNNNNNGG 3 cut(s) 362, 382, 475
BseNI ACTGG 3 cut(s) 341, 403, 469
BseXI GCAGC 2 cut(s) 19, 339
BshFI GGCC 3 cut(s) 51, 468, 479
BsiHKAI GWGCWC 1 cut(s) 390
BsiSI CCGG 3 cut(s) 26, 39, 80
BslI CCNNNNNNNGG 3 cut(s) 362, 382, 475
BsmAI GTCTC 3 cut(s) 121, 173, 384
BsmBI CGTCTC 1 cut(s) 384
BsnI GGCC 3 cut(s) 51, 468, 479
Bsp1286I GDGCHC 1 cut(s) 390
Bsp143I GATC 2 cut(s) 255, 279
BspACI CCGC 2 cut(s) 501, 504
BspANI GGCC 3 cut(s) 51, 468, 479
BspLI GGNNCC 2 cut(s) 155, 257
BspPI GGATC 2 cut(s) 250, 263
BsrI ACTGG 3 cut(s) 341, 403, 469
BssECI CCNNGG 1 cut(s) 463
BssMI GATC 2 cut(s) 255, 279
Bst2UI CCWGG 2 cut(s) 315, 464
Bst4CI ACNGT 2 cut(s) 115, 186
BstC8I GCNNGC 1 cut(s) 498
BstF5I GGATG 3 cut(s) 35, 104, 257
BstKTI GATC 2 cut(s) 258, 282
BstMAI GTCTC 3 cut(s) 121, 173, 384
BstMBI GATC 2 cut(s) 255, 279
BstMWI GCNNNNNNNGC 2 cut(s) 29, 48
BstNI CCWGG 2 cut(s) 315, 464
BstNSI RCATGY 1 cut(s) 241
BstSCI CCNGG 3 cut(s) 78, 313, 462
BstV1I GCAGC 2 cut(s) 19, 339
BstX2I RGATCY 1 cut(s) 255
BstYI RGATCY 1 cut(s) 255
BsuRI GGCC 3 cut(s) 51, 468, 479
BtsCI GGATG 3 cut(s) 35, 104, 257
BtsI GCAGTG 1 cut(s) 136
BtsIMutI CAGTG 5 cut(s) 136, 182, 369, 410, 476
Cac8I GCNNGC 1 cut(s) 498
Cfr13I GGNCC 2 cut(s) 102, 466
CviAII CATG 3 cut(s) 142, 238, 358
CviJI RGCY 9 cut(s) 42, 51, 318, 352, 416, 468, 479, 496, 500
CviKI_1 RGCY 9 cut(s) 42, 51, 318, 352, 416, 468, 479, 496, 500
DpnI GATC 2 cut(s) 257, 281
DpnII GATC 2 cut(s) 255, 279
Eco47I GGWCC 1 cut(s) 102
EcoRI GAATTC 1 cut(s) 269
EcoRII CCWGG 2 cut(s) 313, 462
Esp3I CGTCTC 1 cut(s) 384
FaeI CATG 3 cut(s) 145, 241, 361
FaiI YATR 9 cut(s) 143, 151, 239, 288, 359, 432, 434, 443, 476
FatI CATG 3 cut(s) 141, 237, 357
Fnu4HI GCNGC 4 cut(s) 33, 353, 501, 504
FokI GGATG 3 cut(s) 22, 111, 264
Fsp4HI GCNGC 4 cut(s) 33, 353, 501, 504
GluI GCNGC 4 cut(s) 33, 353, 501, 504
HaeIII GGCC 3 cut(s) 51, 468, 479
HapII CCGG 3 cut(s) 26, 39, 80
Hin1II CATG 3 cut(s) 145, 241, 361
HincII GTYRAC 1 cut(s) 57
HindII GTYRAC 1 cut(s) 57
HinfI GANTC 2 cut(s) 89, 212
HpaII CCGG 3 cut(s) 26, 39, 80
HphI GGTGA 1 cut(s) 505
Hpy166II GTNNAC 1 cut(s) 57
Hpy188I TCNGA 3 cut(s) 69, 208, 492
Hpy188III TCNNGA 2 cut(s) 129, 244
Hpy8I GTNNAC 1 cut(s) 57
HpyAV CCTTC 2 cut(s) 139, 203
HpyCH4III ACNGT 2 cut(s) 115, 186
HpyCH4IV ACGT 1 cut(s) 45
HpyCH4V TGCA 6 cut(s) 11, 35, 141, 221, 369, 408
HpyF10VI GCNNNNNNNGC 2 cut(s) 29, 48
HpySE526I ACGT 1 cut(s) 45
Hsp92II CATG 3 cut(s) 145, 241, 361
Kzo9I GATC 2 cut(s) 255, 279
LmnI GCTCC 1 cut(s) 28
Lsp1109I GCAGC 2 cut(s) 19, 339
LweI GCATC 2 cut(s) 44, 300
MaeII ACGT 1 cut(s) 45
MalI GATC 2 cut(s) 257, 281
MboI GATC 2 cut(s) 255, 279
MboII GAAGA 1 cut(s) 7
MfeI CAATTG 1 cut(s) 216
MflI RGATCY 1 cut(s) 255
MhlI GDGCHC 1 cut(s) 390
MluCI AATT 3 cut(s) 72, 216, 269
MnlI CCTC 2 cut(s) 75, 275
MroXI GAANNNNTTC 1 cut(s) 74
MseI TTAA 2 cut(s) 84, 526
MspI CCGG 3 cut(s) 26, 39, 80
MspR9I CCNGG 3 cut(s) 80, 315, 464
MunI CAATTG 1 cut(s) 216
MvaI CCWGG 2 cut(s) 315, 464
MwoI GCNNNNNNNGC 2 cut(s) 29, 48
NciI CCSGG 1 cut(s) 80
NdeII GATC 2 cut(s) 255, 279
NlaIII CATG 3 cut(s) 145, 241, 361
NlaIV GGNNCC 2 cut(s) 155, 257
NspI RCATGY 1 cut(s) 241
PdmI GAANNNNTTC 1 cut(s) 74
PfeI GAWTC 2 cut(s) 89, 212
PflFI GACNNNGTC 1 cut(s) 184
PflMI CCANNNNNTGG 1 cut(s) 475
PkrI GCNGC 4 cut(s) 34, 354, 502, 505
Psp6I CCWGG 2 cut(s) 313, 462
PspGI CCWGG 2 cut(s) 313, 462
PspN4I GGNNCC 2 cut(s) 155, 257
PspPI GGNCC 2 cut(s) 102, 466
PsuI RGATCY 1 cut(s) 255
PsyI GACNNNGTC 1 cut(s) 184
SaqAI TTAA 2 cut(s) 84, 526
SatI GCNGC 4 cut(s) 33, 353, 501, 504
Sau3AI GATC 2 cut(s) 255, 279
Sau96I GGNCC 2 cut(s) 102, 466
ScrFI CCNGG 3 cut(s) 80, 315, 464
SduI GDGCHC 1 cut(s) 390
SetI ASST 5 cut(s) 48, 150, 195, 354, 418
SfaNI GCATC 2 cut(s) 44, 300
SinI GGWCC 1 cut(s) 102
SmlI CTYRAG 1 cut(s) 242
SmoI CTYRAG 1 cut(s) 242
Sse9I AATT 3 cut(s) 72, 216, 269
SsiI CCGC 2 cut(s) 501, 504
StyD4I CCNGG 3 cut(s) 78, 313, 462
TaaI ACNGT 2 cut(s) 115, 186
TaiI ACGT 1 cut(s) 48
TaqI TCGA 3 cut(s) 92, 267, 273
TasI AATT 3 cut(s) 72, 216, 269
TauI GCSGC 2 cut(s) 503, 506
TfiI GAWTC 2 cut(s) 89, 212
Tru1I TTAA 2 cut(s) 84, 526
Tru9I TTAA 2 cut(s) 84, 526
TscAI CASTG 5 cut(s) 143, 189, 376, 410, 476
TseI GCWGC 2 cut(s) 32, 352
TspDTI ATGAA 2 cut(s) 158, 408
TspRI CASTG 5 cut(s) 143, 189, 376, 410, 476
Tth111I GACNNNGTC 1 cut(s) 184
Van91I CCANNNNNTGG 1 cut(s) 475
VpaK11BI GGWCC 1 cut(s) 102
XapI RAATTY 2 cut(s) 72, 269
XceI RCATGY 1 cut(s) 241
XmnI GAANNNNTTC 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.