pycom13g22570

RuBisCO catalyzes two reactions the carboxylation of D- ribulose 1,5-bisphosphate, the primary event in carbon dioxide fixation, as well as the oxidative fragmentation of the pentose substrate. Both reactions occur simultaneously and in competition at the same active site

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
20174385 .. 20175426
1042 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g22570.2

Sequence Viewer

Length: 543 bp
ATGTCTGCTGCGATCTTTATTGCTCCGGTTGGTGCATCCGGTTATGCTGGCTTGAAAGCCAACCCTCGGAAGCTTTTTCCGGTGAATGATTCTATTGGATGGGCCAAGAAAACGGTCTCCAATGGATCAAGAACTCTCTGCATGAAGGTGTGGAATCCAATCAACAACAAGAAGTTCGAGACCCTCTCGTACCTACCACCACTCTCTGATGATTCTATTGCCAAGGAGATTGACTACATGCTCAAGAAGGGATGGATCCCTTGCCTCGAATTCGATGAGGTTGGGTATGTTTACAGGGAGAATAGCCAGATGCCAGGGTATTATGATGGGAGATACTGGACATTGTGGAAGCTGCCCATGTTTGGTTGTACTGATCCGTCGCTAGTTCTCAATGAAATCCAGCAGTGCAAAACAGAATACCCGAATGCTTATATTCGCTGCATGGCATTCGACAACGTCAACCAGGGTCAGTGCATGGCCTTTATCATTCAGAAGCCAACAGCTACTGCCGCCGCTGCCGCCACCACCACCGCCGATGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

181

Amino Acids

20.08

Weight (kDa)

8.15

Isoelectric Point (pI)

39.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014712)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 510, 513, 519, 531
AclWI GGATC 4 cut(s) 133, 250, 263, 368
AcsI RAATTY 1 cut(s) 269
AfaI GTAC 2 cut(s) 191, 370
AfiI CCNNNNNNNGG 2 cut(s) 66, 362
AgsI TTSAA 1 cut(s) 55
AjnI CCWGG 2 cut(s) 313, 462
AluBI AGCT 3 cut(s) 73, 352, 503
AluI AGCT 3 cut(s) 73, 352, 503
Alw26I GTCTC 2 cut(s) 121, 173
AlwI GGATC 4 cut(s) 133, 250, 263, 368
AlwNI CAGNNNCTG 1 cut(s) 506
AoxI GGCC 2 cut(s) 102, 477
ApeKI GCWGC 4 cut(s) 8, 352, 438, 515
ApoI RAATTY 1 cut(s) 269
AspS9I GGNCC 1 cut(s) 102
AsuHPI GGTGA 1 cut(s) 94
BamHI GGATCC 1 cut(s) 255
BbvI GCAGC 3 cut(s) 339, 425, 502
BccI CCATC 3 cut(s) 93, 246, 320
BcgI CGANNNNNNTGC 2 cut(s) 430, 464
BciT130I CCWGG 2 cut(s) 315, 464
BcoDI GTCTC 2 cut(s) 121, 173
BfaI CTAG 1 cut(s) 383
BisI GCNGC 7 cut(s) 9, 353, 439, 510, 513, 516, 519
BlsI GCNGC 7 cut(s) 10, 354, 440, 511, 514, 517, 520
Bme1390I CCNGG 2 cut(s) 315, 464
BmgT120I GGNCC 1 cut(s) 102
BmiI GGNNCC 1 cut(s) 257
BmrFI CCNGG 2 cut(s) 315, 464
BmsI GCATC 3 cut(s) 44, 300, 526
BplI GAGNNNNNCTC 2 cut(s) 170, 202
BpuEI CTTGAG 1 cut(s) 227
BsaI GGTCTC 2 cut(s) 121, 173
BsaJI CCNNGG 4 cut(s) 65, 222, 314, 463
BsaWI WCCGGW 3 cut(s) 25, 38, 79
Bsc4I CCNNNNNNNGG 2 cut(s) 66, 362
Bse1I ACTGG 1 cut(s) 341
BseBI CCWGG 2 cut(s) 315, 464
BseDI CCNNGG 4 cut(s) 65, 222, 314, 463
BseGI GGATG 3 cut(s) 35, 104, 257
BseLI CCNNNNNNNGG 2 cut(s) 66, 362
BseNI ACTGG 1 cut(s) 341
BseXI GCAGC 3 cut(s) 339, 425, 502
BshFI GGCC 2 cut(s) 104, 479
BsiSI CCGG 3 cut(s) 26, 39, 80
BslI CCNNNNNNNGG 2 cut(s) 66, 362
BsmAI GTCTC 2 cut(s) 121, 173
BsmI GAATGC 2 cut(s) 430, 446
BsnI GGCC 2 cut(s) 104, 479
Bso31I GGTCTC 2 cut(s) 121, 173
Bsp143I GATC 4 cut(s) 12, 125, 255, 373
BspACI CCGC 4 cut(s) 510, 513, 519, 531
BspANI GGCC 2 cut(s) 104, 479
BspLI GGNNCC 1 cut(s) 257
BspPI GGATC 4 cut(s) 133, 250, 263, 368
BspTNI GGTCTC 2 cut(s) 121, 173
BsrI ACTGG 1 cut(s) 341
BssECI CCNNGG 4 cut(s) 65, 222, 314, 463
BssMI GATC 4 cut(s) 12, 125, 255, 373
BssT1I CCWWGG 1 cut(s) 222
Bst2UI CCWGG 2 cut(s) 315, 464
Bst4CI ACNGT 1 cut(s) 115
BstC8I GCNNGC 1 cut(s) 49
BstF5I GGATG 3 cut(s) 35, 104, 257
BstKTI GATC 4 cut(s) 15, 128, 258, 376
BstMAI GTCTC 2 cut(s) 121, 173
BstMBI GATC 4 cut(s) 12, 125, 255, 373
BstMWI GCNNNNNNNGC 3 cut(s) 509, 515, 518
BstNI CCWGG 2 cut(s) 315, 464
BstNSI RCATGY 1 cut(s) 241
BstSCI CCNGG 2 cut(s) 313, 462
BstV1I GCAGC 3 cut(s) 339, 425, 502
BstX2I RGATCY 1 cut(s) 255
BstYI RGATCY 1 cut(s) 255
BsuRI GGCC 2 cut(s) 104, 479
BtsCI GGATG 3 cut(s) 35, 104, 257
BtsI GCAGTG 1 cut(s) 410
BtsIMutI CAGTG 2 cut(s) 410, 476
Cac8I GCNNGC 1 cut(s) 49
CaiI CAGNNNCTG 1 cut(s) 506
Cfr13I GGNCC 1 cut(s) 102
Csp6I GTAC 2 cut(s) 190, 369
CviAII CATG 5 cut(s) 142, 238, 358, 442, 475
CviJI RGCY 9 cut(s) 51, 59, 73, 104, 306, 352, 479, 496, 503
CviKI_1 RGCY 9 cut(s) 51, 59, 73, 104, 306, 352, 479, 496, 503
CviQI GTAC 2 cut(s) 190, 369
DpnI GATC 4 cut(s) 14, 127, 257, 375
DpnII GATC 4 cut(s) 12, 125, 255, 373
Eco130I CCWWGG 1 cut(s) 222
Eco31I GGTCTC 2 cut(s) 121, 173
EcoRI GAATTC 1 cut(s) 269
EcoRII CCWGG 2 cut(s) 313, 462
EcoT14I CCWWGG 1 cut(s) 222
ErhI CCWWGG 1 cut(s) 222
FaeI CATG 5 cut(s) 145, 241, 361, 445, 478
FaiI YATR 9 cut(s) 45, 143, 239, 288, 324, 359, 432, 443, 476
FatI CATG 5 cut(s) 141, 237, 357, 441, 474
Fnu4HI GCNGC 7 cut(s) 9, 353, 439, 510, 513, 516, 519
FokI GGATG 3 cut(s) 22, 111, 264
Fsp4HI GCNGC 7 cut(s) 9, 353, 439, 510, 513, 516, 519
FspBI CTAG 1 cut(s) 383
GluI GCNGC 7 cut(s) 9, 353, 439, 510, 513, 516, 519
HaeIII GGCC 2 cut(s) 104, 479
HapII CCGG 3 cut(s) 26, 39, 80
Hin1II CATG 5 cut(s) 145, 241, 361, 445, 478
HincII GTYRAC 1 cut(s) 460
HindII GTYRAC 1 cut(s) 460
HindIII AAGCTT 1 cut(s) 71
HinfI GANTC 3 cut(s) 89, 154, 212
HpaII CCGG 3 cut(s) 26, 39, 80
HphI GGTGA 1 cut(s) 94
Hpy166II GTNNAC 2 cut(s) 292, 460
Hpy188I TCNGA 3 cut(s) 69, 208, 492
Hpy188III TCNNGA 3 cut(s) 129, 178, 244
Hpy8I GTNNAC 2 cut(s) 292, 460
Hpy99I CGWCG 1 cut(s) 382
HpyAV CCTTC 2 cut(s) 139, 241
HpyCH4III ACNGT 1 cut(s) 115
HpyCH4IV ACGT 1 cut(s) 456
HpyCH4V TGCA 5 cut(s) 35, 141, 408, 441, 474
HpyF10VI GCNNNNNNNGC 3 cut(s) 509, 515, 518
HpySE526I ACGT 1 cut(s) 456
Hsp92II CATG 5 cut(s) 145, 241, 361, 445, 478
Kzo9I GATC 4 cut(s) 12, 125, 255, 373
LmnI GCTCC 1 cut(s) 28
Lsp1109I GCAGC 3 cut(s) 339, 425, 502
LweI GCATC 3 cut(s) 44, 300, 526
MaeI CTAG 1 cut(s) 383
MaeII ACGT 1 cut(s) 456
MalI GATC 4 cut(s) 14, 127, 257, 375
MboI GATC 4 cut(s) 12, 125, 255, 373
MflI RGATCY 1 cut(s) 255
MluCI AATT 1 cut(s) 269
MnlI CCTC 4 cut(s) 75, 194, 271, 275
MseI TTAA 1 cut(s) 541
MslI CAYNNNNRTG 1 cut(s) 146
MspA1I CMGCKG 1 cut(s) 515
MspI CCGG 3 cut(s) 26, 39, 80
MspR9I CCNGG 2 cut(s) 315, 464
Mva1269I GAATGC 2 cut(s) 430, 446
MvaI CCWGG 2 cut(s) 315, 464
MwoI GCNNNNNNNGC 3 cut(s) 509, 515, 518
NdeII GATC 4 cut(s) 12, 125, 255, 373
NlaIII CATG 5 cut(s) 145, 241, 361, 445, 478
NlaIV GGNNCC 1 cut(s) 257
NspI RCATGY 1 cut(s) 241
PctI GAATGC 2 cut(s) 430, 446
PfeI GAWTC 3 cut(s) 89, 154, 212
PflFI GACNNNGTC 1 cut(s) 455
PkrI GCNGC 7 cut(s) 10, 354, 440, 511, 514, 517, 520
Psp6I CCWGG 2 cut(s) 313, 462
PspGI CCWGG 2 cut(s) 313, 462
PspN4I GGNNCC 1 cut(s) 257
PspPI GGNCC 1 cut(s) 102
PstNI CAGNNNCTG 1 cut(s) 506
PsuI RGATCY 1 cut(s) 255
PsyI GACNNNGTC 1 cut(s) 455
RsaI GTAC 2 cut(s) 191, 370
RsaNI GTAC 2 cut(s) 190, 369
RseI CAYNNNNRTG 1 cut(s) 146
SaqAI TTAA 1 cut(s) 541
SatI GCNGC 7 cut(s) 9, 353, 439, 510, 513, 516, 519
Sau3AI GATC 4 cut(s) 12, 125, 255, 373
Sau96I GGNCC 1 cut(s) 102
ScrFI CCNGG 2 cut(s) 315, 464
SetI ASST 7 cut(s) 75, 150, 195, 282, 354, 459, 505
SfaNI GCATC 3 cut(s) 44, 300, 526
SmiMI CAYNNNNRTG 1 cut(s) 146
SmlI CTYRAG 1 cut(s) 242
SmoI CTYRAG 1 cut(s) 242
Sse9I AATT 1 cut(s) 269
SsiI CCGC 4 cut(s) 510, 513, 519, 531
SspMI CTAG 1 cut(s) 383
StyD4I CCNGG 2 cut(s) 313, 462
StyI CCWWGG 1 cut(s) 222
TaaI ACNGT 1 cut(s) 115
TaiI ACGT 1 cut(s) 459
TaqI TCGA 4 cut(s) 177, 267, 273, 450
TasI AATT 1 cut(s) 269
TatI WGTACW 1 cut(s) 368
TauI GCSGC 3 cut(s) 512, 515, 521
TfiI GAWTC 3 cut(s) 89, 154, 212
Tru1I TTAA 1 cut(s) 541
Tru9I TTAA 1 cut(s) 541
TscAI CASTG 2 cut(s) 410, 476
TseI GCWGC 4 cut(s) 8, 352, 438, 515
TspDTI ATGAA 2 cut(s) 158, 408
TspGWI ACGGA 1 cut(s) 366
TspRI CASTG 2 cut(s) 410, 476
Tth111I GACNNNGTC 1 cut(s) 455
XapI RAATTY 1 cut(s) 269
XceI RCATGY 1 cut(s) 241
XspI CTAG 1 cut(s) 383
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.