MD13G1252300.v1.1

RuBisCO catalyzes two reactions the carboxylation of D- ribulose 1,5-bisphosphate, the primary event in carbon dioxide fixation, as well as the oxidative fragmentation of the pentose substrate. Both reactions occur simultaneously and in competition at the same active site

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
OG0014712
Physical Location & Seq
Reverse (-)
26924710 .. 26926617
1908 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1252300.v1.1.491

Sequence Viewer

Length: 303 bp
ATGCTCAAGAAGGGATGGATCCCTTGCCTCGAATTCGATGAGGTTGGGTATGTCTACAGGGAGAATAGCCAGATGCCAGGGTATTATGATGGGAGATACTGGACATTGTGGAAGCTGCCCATGTTTGGTTGTTCTGATCCGTCGCTCGTTCTCAATGAAATCCAGCAGTGCAAAACAGAATACCCGAATGCTTATATTCGCTGCGTGGCATTCGACAACGTCAACCAGGGTCAGTGCATGGCCTTTATCATTCAGAAGCCAACAGCTACCGCCGCCGCCGCCACCACCACCGCTGACGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00630 ko00710 ko01100 ko01120 ko01200 map00630 map00710 map01100 map01120 map01200
Pfam Domains
Protein Families
RuBisCO_small

Protein Analysis

101

Amino Acids

11.36

Weight (kDa)

4.89

Isoelectric Point (pI)

25.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RuBisCO_small PF00101 1 - 87 2.4e-28 Ribulose bisphosphate carboxylase, small chain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014712)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g08000 FvH4_4g08000
malus_domestica MD04G1188500.v1.1 MD13G1252300.v1.1
prunus_persica Prupe.1G084500_v2.0.a1
pyrus_communis pycom13g22570
rosa_chinensis RchiOBHm_Chr4g0401741
rosa_laevigata RLG00000009138
rosa_multiflora Rmu_sc0001405.1_g000012 Rmu_sc0012591.1_g000003
rosa_roxburghii Rroxscaffold_5G00346210
rosa_rugosa Rorug04G0031400
rosa_samantha Rh4AG108600 Rh4BG102300 Rh4CG116800 Rh4DG100300
rosa_wichuraiana Rw4G008830

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 54
AciI CCGC 5 cut(s) 270, 273, 276, 279, 291
AclWI GGATC 3 cut(s) 13, 26, 131
AcsI RAATTY 1 cut(s) 32
AfiI CCNNNNNNNGG 1 cut(s) 125
AjnI CCWGG 2 cut(s) 76, 225
AluBI AGCT 2 cut(s) 115, 266
AluI AGCT 2 cut(s) 115, 266
AlwI GGATC 3 cut(s) 13, 26, 131
AoxI GGCC 1 cut(s) 240
ApeKI GCWGC 2 cut(s) 115, 201
ApoI RAATTY 1 cut(s) 32
BamHI GGATCC 1 cut(s) 18
BbvI GCAGC 2 cut(s) 102, 188
BccI CCATC 2 cut(s) 9, 83
BciT130I CCWGG 2 cut(s) 78, 227
BfmI CTRYAG 1 cut(s) 55
BisI GCNGC 5 cut(s) 116, 202, 273, 276, 279
BlsI GCNGC 5 cut(s) 117, 203, 274, 277, 280
Bme1390I CCNGG 2 cut(s) 78, 227
BmiI GGNNCC 1 cut(s) 20
BmrFI CCNGG 2 cut(s) 78, 227
BmsI GCATC 1 cut(s) 63
BsaJI CCNNGG 2 cut(s) 77, 226
Bsc4I CCNNNNNNNGG 1 cut(s) 125
Bse1I ACTGG 1 cut(s) 104
BseBI CCWGG 2 cut(s) 78, 227
BseDI CCNNGG 2 cut(s) 77, 226
BseGI GGATG 1 cut(s) 20
BseLI CCNNNNNNNGG 1 cut(s) 125
BseNI ACTGG 1 cut(s) 104
BseXI GCAGC 2 cut(s) 102, 188
BshFI GGCC 1 cut(s) 242
BslI CCNNNNNNNGG 1 cut(s) 125
BsmI GAATGC 2 cut(s) 193, 209
BsnI GGCC 1 cut(s) 242
Bsp143I GATC 2 cut(s) 18, 136
BspACI CCGC 5 cut(s) 270, 273, 276, 279, 291
BspANI GGCC 1 cut(s) 242
BspLI GGNNCC 1 cut(s) 20
BspPI GGATC 3 cut(s) 13, 26, 131
BsrI ACTGG 1 cut(s) 104
BssECI CCNNGG 2 cut(s) 77, 226
BssMI GATC 2 cut(s) 18, 136
Bst2UI CCWGG 2 cut(s) 78, 227
BstF5I GGATG 1 cut(s) 20
BstKTI GATC 2 cut(s) 21, 139
BstMBI GATC 2 cut(s) 18, 136
BstMWI GCNNNNNNNGC 2 cut(s) 272, 278
BstNI CCWGG 2 cut(s) 78, 227
BstSCI CCNGG 2 cut(s) 76, 225
BstSFI CTRYAG 1 cut(s) 55
BstV1I GCAGC 2 cut(s) 102, 188
BstX2I RGATCY 1 cut(s) 18
BstYI RGATCY 1 cut(s) 18
BsuRI GGCC 1 cut(s) 242
BtsCI GGATG 1 cut(s) 20
BtsI GCAGTG 1 cut(s) 173
BtsIMutI CAGTG 2 cut(s) 173, 239
CviAII CATG 2 cut(s) 121, 238
CviJI RGCY 5 cut(s) 69, 115, 242, 259, 266
CviKI_1 RGCY 5 cut(s) 69, 115, 242, 259, 266
DpnI GATC 2 cut(s) 20, 138
DpnII GATC 2 cut(s) 18, 136
EcoRI GAATTC 1 cut(s) 32
EcoRII CCWGG 2 cut(s) 76, 225
FaeI CATG 2 cut(s) 124, 241
FaiI YATR 5 cut(s) 51, 87, 122, 195, 239
FatI CATG 2 cut(s) 120, 237
FblI GTMKAC 1 cut(s) 54
Fnu4HI GCNGC 5 cut(s) 116, 202, 273, 276, 279
FokI GGATG 1 cut(s) 27
Fsp4HI GCNGC 5 cut(s) 116, 202, 273, 276, 279
GluI GCNGC 5 cut(s) 116, 202, 273, 276, 279
HaeIII GGCC 1 cut(s) 242
Hin1II CATG 2 cut(s) 124, 241
HincII GTYRAC 1 cut(s) 223
HindII GTYRAC 1 cut(s) 223
Hpy166II GTNNAC 2 cut(s) 55, 223
Hpy188I TCNGA 2 cut(s) 136, 255
Hpy188III TCNNGA 1 cut(s) 7
Hpy8I GTNNAC 2 cut(s) 55, 223
Hpy99I CGWCG 1 cut(s) 145
HpyAV CCTTC 1 cut(s) 4
HpyCH4IV ACGT 1 cut(s) 219
HpyCH4V TGCA 2 cut(s) 171, 237
HpyF10VI GCNNNNNNNGC 2 cut(s) 272, 278
HpySE526I ACGT 1 cut(s) 219
Hsp92II CATG 2 cut(s) 124, 241
Kzo9I GATC 2 cut(s) 18, 136
LpnPI CCDG 8 cut(s) 43, 63, 83, 85, 90, 176, 212, 239
Lsp1109I GCAGC 2 cut(s) 102, 188
LweI GCATC 1 cut(s) 63
MaeII ACGT 1 cut(s) 219
MalI GATC 2 cut(s) 20, 138
MboI GATC 2 cut(s) 18, 136
MflI RGATCY 1 cut(s) 18
MluCI AATT 1 cut(s) 32
MnlI CCTC 2 cut(s) 34, 38
MseI TTAA 1 cut(s) 301
MspA1I CMGCKG 1 cut(s) 293
MspR9I CCNGG 2 cut(s) 78, 227
Mva1269I GAATGC 2 cut(s) 193, 209
MvaI CCWGG 2 cut(s) 78, 227
MwoI GCNNNNNNNGC 2 cut(s) 272, 278
NdeII GATC 2 cut(s) 18, 136
NlaIII CATG 2 cut(s) 124, 241
NlaIV GGNNCC 1 cut(s) 20
PctI GAATGC 2 cut(s) 193, 209
PflFI GACNNNGTC 1 cut(s) 218
PkrI GCNGC 5 cut(s) 117, 203, 274, 277, 280
Psp6I CCWGG 2 cut(s) 76, 225
PspGI CCWGG 2 cut(s) 76, 225
PspN4I GGNNCC 1 cut(s) 20
PsuI RGATCY 1 cut(s) 18
PsyI GACNNNGTC 1 cut(s) 218
SaqAI TTAA 1 cut(s) 301
SatI GCNGC 5 cut(s) 116, 202, 273, 276, 279
Sau3AI GATC 2 cut(s) 18, 136
ScrFI CCNGG 2 cut(s) 78, 227
SetI ASST 4 cut(s) 45, 117, 222, 268
SfaNI GCATC 1 cut(s) 63
SfcI CTRYAG 1 cut(s) 55
SmlI CTYRAG 1 cut(s) 5
SmoI CTYRAG 1 cut(s) 5
Sse9I AATT 1 cut(s) 32
SsiI CCGC 5 cut(s) 270, 273, 276, 279, 291
StyD4I CCNGG 2 cut(s) 76, 225
TaiI ACGT 1 cut(s) 222
TaqI TCGA 3 cut(s) 30, 36, 213
TasI AATT 1 cut(s) 32
TauI GCSGC 3 cut(s) 275, 278, 281
Tru1I TTAA 1 cut(s) 301
Tru9I TTAA 1 cut(s) 301
TscAI CASTG 2 cut(s) 173, 239
TseI GCWGC 2 cut(s) 115, 201
TspDTI ATGAA 1 cut(s) 171
TspGWI ACGGA 1 cut(s) 129
TspRI CASTG 2 cut(s) 173, 239
Tth111I GACNNNGTC 1 cut(s) 218
XapI RAATTY 1 cut(s) 32
XmiI GTMKAC 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.