FvH4_4g17800

F-box FBD LRR-repeat protein

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
Physical Location & Seq
Forward (+)
21794722 .. 21796019
1298 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g17800.t1

Sequence Viewer

Length: 504 bp
ATGACTCTATGTGACGTGAAGAGTGTCACCCTTCTTAAGATTGATTCACCAAATCTCCAATTCCTTAATGTTCGAGTTGGTCGTTGGAGTTTTAGTCTTAATGATACCCCAACTCTTGTTGGTATGAAATTAACAGGTTTCCGTGGTGTGAGGGGTGAAGTAGACTTACTCAGATCTATGCTATCAACCTCCACTCTTCAAGAACTAGAAATTTCATTTGGACAGCAAAGTAAGATGGTAAAGTTAAATGATGACGACTGGAATTGCACTTCCAACCTACTGCGAGTTTTAAAGATAACTGGTTTTTCTGGTGAATCCGAAAACGAAAGAAATTTCATCCGATTTCTGCTTTCAAGAACACCTGTCCTTGAGAGGATGACTCTTCAACCTTCTTCTACCCTTGTTTCTTGGGAACTACCCCAAATGTTGGAAGGTTATAGGCATGTGAAGAAAAATTTCATTGACCCGTCAACTTCATCCCCATTTTTTCATCTGGAGAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

168

Amino Acids

19.06

Weight (kDa)

7.8

Isoelectric Point (pI)

45.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018419)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 427
AccI GTMKAC 1 cut(s) 162
AcsI RAATTY 3 cut(s) 210, 331, 454
AfiI CCNNNNNNNGG 1 cut(s) 427
AflII CTTAAG 1 cut(s) 35
AgsI TTSAA 3 cut(s) 200, 354, 386
AjiI CACGTC 1 cut(s) 16
AjuI GAANNNNNNNTTGG 2 cut(s) 201, 233
ApoI RAATTY 3 cut(s) 210, 331, 454
Asp700I GAANNNNTTC 1 cut(s) 455
AsuHPI GGTGA 4 cut(s) 19, 39, 167, 323
BarI GAAGNNNNNNTAC 2 cut(s) 150, 182
BccI CCATC 1 cut(s) 229
BfaI CTAG 1 cut(s) 206
BfrI CTTAAG 1 cut(s) 35
BglII AGATCT 1 cut(s) 173
BmgBI CACGTC 1 cut(s) 16
BplI GAGNNNNNCTC 2 cut(s) 364, 396
BpuEI CTTGAG 1 cut(s) 389
BsaJI CCNNGG 1 cut(s) 142
BsaXI ACNNNNNCTCC 4 cut(s) 39, 69, 79, 109
Bsc4I CCNNNNNNNGG 1 cut(s) 427
Bse1I ACTGG 2 cut(s) 263, 304
BseDI CCNNGG 1 cut(s) 142
BseGI GGATG 3 cut(s) 336, 381, 476
BseLI CCNNNNNNNGG 1 cut(s) 427
BseMII CTCAG 1 cut(s) 184
BseNI ACTGG 2 cut(s) 263, 304
BslI CCNNNNNNNGG 1 cut(s) 427
Bsp143I GATC 1 cut(s) 173
BspCNI CTCAG 1 cut(s) 183
BspTI CTTAAG 1 cut(s) 35
BsrI ACTGG 2 cut(s) 263, 304
BssECI CCNNGG 1 cut(s) 142
BssMI GATC 1 cut(s) 173
Bst6I CTCTTC 3 cut(s) 14, 201, 387
BstAFI CTTAAG 1 cut(s) 35
BstDEI CTNAG 1 cut(s) 170
BstDSI CCRYGG 1 cut(s) 142
BstF5I GGATG 3 cut(s) 336, 381, 476
BstKTI GATC 1 cut(s) 176
BstMBI GATC 1 cut(s) 173
BstNSI RCATGY 1 cut(s) 446
BstX2I RGATCY 1 cut(s) 173
BstYI RGATCY 1 cut(s) 173
BtgI CCRYGG 1 cut(s) 142
BtrI CACGTC 1 cut(s) 16
BtsCI GGATG 3 cut(s) 336, 381, 476
CviAII CATG 1 cut(s) 443
DdeI CTNAG 1 cut(s) 170
DpnI GATC 1 cut(s) 175
DpnII GATC 1 cut(s) 173
DraI TTTAAA 1 cut(s) 291
Eam1104I CTCTTC 3 cut(s) 14, 201, 387
EarI CTCTTC 3 cut(s) 14, 201, 387
FaeI CATG 1 cut(s) 446
FaiI YATR 5 cut(s) 10, 125, 179, 438, 444
FatI CATG 1 cut(s) 442
FblI GTMKAC 1 cut(s) 162
FokI GGATG 3 cut(s) 323, 388, 463
FspBI CTAG 1 cut(s) 206
Hin1II CATG 1 cut(s) 446
HincII GTYRAC 1 cut(s) 471
HindII GTYRAC 1 cut(s) 471
HinfI GANTC 4 cut(s) 4, 44, 314, 379
HphI GGTGA 4 cut(s) 19, 39, 167, 323
Hpy166II GTNNAC 2 cut(s) 163, 471
Hpy188I TCNGA 3 cut(s) 173, 319, 341
Hpy188III TCNNGA 3 cut(s) 200, 354, 494
Hpy8I GTNNAC 2 cut(s) 163, 471
HpyAV CCTTC 3 cut(s) 41, 399, 425
HpyCH4IV ACGT 1 cut(s) 15
HpyCH4V TGCA 1 cut(s) 267
HpyF3I CTNAG 1 cut(s) 170
HpySE526I ACGT 1 cut(s) 15
Hsp92II CATG 1 cut(s) 446
Kzo9I GATC 1 cut(s) 173
LpnPI CCDG 6 cut(s) 120, 244, 285, 294, 375, 479
MaeI CTAG 1 cut(s) 206
MaeII ACGT 1 cut(s) 15
MaeIII GTNAC 2 cut(s) 11, 25
MalI GATC 1 cut(s) 175
MboI GATC 1 cut(s) 173
MboII GAAGA 5 cut(s) 31, 188, 374, 384, 460
MflI RGATCY 1 cut(s) 173
MluCI AATT 6 cut(s) 59, 128, 210, 262, 331, 454
MlyI GAGTC 1 cut(s) 373
MmeI TCCRAC 3 cut(s) 65, 297, 408
MnlI CCTC 3 cut(s) 144, 199, 366
MroXI GAANNNNTTC 1 cut(s) 455
MseI TTAA 7 cut(s) 36, 66, 99, 131, 245, 290, 502
MspCI CTTAAG 1 cut(s) 35
NdeII GATC 1 cut(s) 173
NlaIII CATG 1 cut(s) 446
NmuCI GTSAC 2 cut(s) 11, 25
NspI RCATGY 1 cut(s) 446
PcsI WCGNNNNNNNCGW 1 cut(s) 79
PdmI GAANNNNTTC 1 cut(s) 455
PfeI GAWTC 2 cut(s) 44, 314
PflMI CCANNNNNTGG 1 cut(s) 427
PleI GAGTC 1 cut(s) 373
PpsI GAGTC 1 cut(s) 373
PsuI RGATCY 1 cut(s) 173
SaqAI TTAA 7 cut(s) 36, 66, 99, 131, 245, 290, 502
Sau3AI GATC 1 cut(s) 173
SchI GAGTC 1 cut(s) 373
SetI ASST 7 cut(s) 18, 139, 191, 279, 364, 391, 436
SmlI CTYRAG 2 cut(s) 35, 368
SmoI CTYRAG 2 cut(s) 35, 368
Sse9I AATT 6 cut(s) 59, 128, 210, 262, 331, 454
SspMI CTAG 1 cut(s) 206
TaiI ACGT 1 cut(s) 18
TaqI TCGA 1 cut(s) 73
TasI AATT 6 cut(s) 59, 128, 210, 262, 331, 454
TfiI GAWTC 2 cut(s) 44, 314
Tru1I TTAA 7 cut(s) 36, 66, 99, 131, 245, 290, 502
Tru9I TTAA 7 cut(s) 36, 66, 99, 131, 245, 290, 502
TseFI GTSAC 2 cut(s) 11, 25
Tsp45I GTSAC 2 cut(s) 11, 25
TspDTI ATGAA 6 cut(s) 140, 204, 325, 448, 465, 479
TspGWI ACGGA 1 cut(s) 131
Van91I CCANNNNNTGG 1 cut(s) 427
Vha464I CTTAAG 1 cut(s) 35
XapI RAATTY 3 cut(s) 210, 331, 454
XceI RCATGY 1 cut(s) 446
XmiI GTMKAC 1 cut(s) 162
XmnI GAANNNNTTC 1 cut(s) 455
XspI CTAG 1 cut(s) 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.