FvH4_5g29841

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
OG0018447
Physical Location & Seq
Forward (+)
20729789 .. 20731877
2089 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g29841.t1

Sequence Viewer

Length: 426 bp
ATGGACGCTAACAACCATGTACTATCACCCCATACTACTCCTCCACTTTCACCTCCACCACAAGAGAGCTCTAGCGATGAGGAGATGAGAAGTCCAAAAGTTGGAGAATTTGGAGGAGCTGAGGCTGGAGATTATGAAGCTTTCGATCTTGATAATTTACCAATAGAGCTCGCTCCACAGGTCCAACTCATCAAGGAGCTTAAGGCACGGATTGCAGCTCAACAAGAGGAAATCAAAATAGCGCAAAGGAAAAATATGTGGCTGCGAGAATGTAATAATGCAATTATTGATCGGATAAATGCTCAACTACTGCAAAGATATTTGGAAGATACAAATGACCAGAATGGTGATGACTCAGGAAACATGGACGAGACTGAGATTGAAGATAATGATGAAGATTCAGATAACGACGACAACATGATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

142

Amino Acids

15.89

Weight (kDa)

4.06

Isoelectric Point (pI)

59.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018447)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g29841
rosa_multiflora Rmu_sc0007408.1_g000011
rosa_roxburghii Rroxscaffold_3G00235700
rosa_samantha Rh2CG299200 Rh2CG367200 Rh2DG336500 Rh6CG404700 Rh7BG351000 Rh7DG355900
rosa_wichuraiana Rw7G030660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 101
AcsI RAATTY 1 cut(s) 107
AfaI GTAC 1 cut(s) 21
AfiI CCNNNNNNNGG 1 cut(s) 101
AflII CTTAAG 1 cut(s) 200
AgsI TTSAA 1 cut(s) 383
AluBI AGCT 6 cut(s) 69, 119, 140, 169, 199, 218
AluI AGCT 6 cut(s) 69, 119, 140, 169, 199, 218
Alw21I GWGCWC 2 cut(s) 71, 171
Alw26I GTCTC 1 cut(s) 365
ApeKI GCWGC 2 cut(s) 215, 262
ApoI RAATTY 1 cut(s) 107
AspLEI GCGC 1 cut(s) 244
AspS9I GGNCC 1 cut(s) 181
AsuHPI GGTGA 3 cut(s) 18, 42, 359
AvaII GGWCC 1 cut(s) 181
BanII GRGCYC 2 cut(s) 71, 171
Bbv12I GWGCWC 2 cut(s) 71, 171
BbvCI CCTCAGC 1 cut(s) 120
BbvI GCAGC 2 cut(s) 227, 249
BcoDI GTCTC 1 cut(s) 365
BfaI CTAG 1 cut(s) 72
BfrI CTTAAG 1 cut(s) 200
BisI GCNGC 2 cut(s) 216, 263
BlsI GCNGC 2 cut(s) 217, 264
Bme18I GGWCC 1 cut(s) 181
BmgT120I GGNCC 1 cut(s) 181
BpmI CTGGAG 1 cut(s) 147
Bpu10I CCTNAGC 1 cut(s) 120
BsaXI ACNNNNNCTCC 2 cut(s) 25, 55
Bsc4I CCNNNNNNNGG 1 cut(s) 101
BseLI CCNNNNNNNGG 1 cut(s) 101
BseMII CTCAG 3 cut(s) 111, 366, 369
BseRI GAGGAG 3 cut(s) 30, 95, 129
BseXI GCAGC 2 cut(s) 227, 249
BsiHKAI GWGCWC 2 cut(s) 71, 171
BslI CCNNNNNNNGG 1 cut(s) 101
BsmAI GTCTC 1 cut(s) 365
Bsp1286I GDGCHC 2 cut(s) 71, 171
Bsp143I GATC 2 cut(s) 145, 289
BspCNI CTCAG 3 cut(s) 112, 367, 368
BspTI CTTAAG 1 cut(s) 200
BssMI GATC 2 cut(s) 145, 289
BstAFI CTTAAG 1 cut(s) 200
BstAPI GCANNNNNTGC 1 cut(s) 212
BstC8I GCNNGC 1 cut(s) 171
BstDEI CTNAG 3 cut(s) 120, 355, 375
BstHHI GCGC 1 cut(s) 244
BstKTI GATC 2 cut(s) 148, 292
BstMAI GTCTC 1 cut(s) 365
BstMBI GATC 2 cut(s) 145, 289
BstMWI GCNNNNNNNGC 1 cut(s) 212
BstV1I GCAGC 2 cut(s) 227, 249
BtgZI GCGATG 1 cut(s) 90
Cac8I GCNNGC 1 cut(s) 171
CfoI GCGC 1 cut(s) 244
Cfr13I GGNCC 1 cut(s) 181
CseI GACGC 1 cut(s) 14
Csp6I GTAC 1 cut(s) 20
CviAII CATG 3 cut(s) 17, 364, 418
CviJI RGCY 8 cut(s) 69, 119, 125, 140, 169, 199, 218, 262
CviKI_1 RGCY 8 cut(s) 69, 119, 125, 140, 169, 199, 218, 262
CviQI GTAC 1 cut(s) 20
DdeI CTNAG 3 cut(s) 120, 355, 375
DpnI GATC 2 cut(s) 147, 291
DpnII GATC 2 cut(s) 145, 289
Ecl136II GAGCTC 2 cut(s) 69, 169
Eco24I GRGCYC 2 cut(s) 71, 171
Eco47I GGWCC 1 cut(s) 181
Eco53kI GAGCTC 2 cut(s) 69, 169
EcoICRI GAGCTC 2 cut(s) 69, 169
EcoT38I GRGCYC 2 cut(s) 71, 171
FaeI CATG 3 cut(s) 20, 367, 421
FaiI YATR 6 cut(s) 18, 33, 135, 257, 365, 419
FatI CATG 3 cut(s) 16, 363, 417
Fnu4HI GCNGC 2 cut(s) 216, 263
FriOI GRGCYC 2 cut(s) 71, 171
Fsp4HI GCNGC 2 cut(s) 216, 263
FspBI CTAG 1 cut(s) 72
GlaI GCGC 1 cut(s) 243
GluI GCNGC 2 cut(s) 216, 263
GsuI CTGGAG 1 cut(s) 147
HgaI GACGC 1 cut(s) 14
HhaI GCGC 1 cut(s) 244
Hin1II CATG 3 cut(s) 20, 367, 421
Hin6I GCGC 1 cut(s) 242
HinP1I GCGC 1 cut(s) 242
HindIII AAGCTT 1 cut(s) 138
HinfI GANTC 2 cut(s) 353, 398
HphI GGTGA 3 cut(s) 18, 42, 359
Hpy188I TCNGA 2 cut(s) 294, 403
Hpy188III TCNNGA 2 cut(s) 149, 357
Hpy99I CGWCG 1 cut(s) 413
HpyCH4V TGCA 3 cut(s) 215, 281, 313
HpyF10VI GCNNNNNNNGC 1 cut(s) 212
HpyF3I CTNAG 3 cut(s) 120, 355, 375
Hsp92II CATG 3 cut(s) 20, 367, 421
HspAI GCGC 1 cut(s) 242
Kzo9I GATC 2 cut(s) 145, 289
LmnI GCTCC 3 cut(s) 116, 178, 196
LpnPI CCDG 4 cut(s) 111, 164, 342, 353
Lsp1109I GCAGC 2 cut(s) 227, 249
MaeI CTAG 1 cut(s) 72
MalI GATC 2 cut(s) 147, 291
MboI GATC 2 cut(s) 145, 289
MboII GAAGA 3 cut(s) 338, 395, 407
MhlI GDGCHC 2 cut(s) 71, 171
MluCI AATT 3 cut(s) 107, 154, 282
MlyI GAGTC 1 cut(s) 347
MmeI TCCRAC 2 cut(s) 82, 208
MnlI CCTC 6 cut(s) 51, 63, 73, 107, 115, 220
MseI TTAA 1 cut(s) 201
MspCI CTTAAG 1 cut(s) 200
MwoI GCNNNNNNNGC 1 cut(s) 212
NdeII GATC 2 cut(s) 145, 289
NlaIII CATG 3 cut(s) 20, 367, 421
PfeI GAWTC 1 cut(s) 398
PflMI CCANNNNNTGG 1 cut(s) 101
PkrI GCNGC 2 cut(s) 217, 264
PleI GAGTC 1 cut(s) 347
PpsI GAGTC 1 cut(s) 347
Psp124BI GAGCTC 2 cut(s) 71, 171
PspPI GGNCC 1 cut(s) 181
RsaI GTAC 1 cut(s) 21
RsaNI GTAC 1 cut(s) 20
SacI GAGCTC 2 cut(s) 71, 171
SaqAI TTAA 1 cut(s) 201
SatI GCNGC 2 cut(s) 216, 263
Sau3AI GATC 2 cut(s) 145, 289
Sau96I GGNCC 1 cut(s) 181
SchI GAGTC 1 cut(s) 347
SduI GDGCHC 2 cut(s) 71, 171
SetI ASST 8 cut(s) 55, 71, 121, 142, 171, 183, 201, 220
SinI GGWCC 1 cut(s) 181
SmlI CTYRAG 1 cut(s) 200
SmoI CTYRAG 1 cut(s) 200
Sse9I AATT 3 cut(s) 107, 154, 282
SspMI CTAG 1 cut(s) 72
SstI GAGCTC 2 cut(s) 71, 171
TaqI TCGA 1 cut(s) 144
TasI AATT 3 cut(s) 107, 154, 282
TatI WGTACW 1 cut(s) 19
TfiI GAWTC 1 cut(s) 398
Tru1I TTAA 1 cut(s) 201
Tru9I TTAA 1 cut(s) 201
TseI GCWGC 2 cut(s) 215, 262
TspDTI ATGAA 2 cut(s) 150, 408
TspGWI ACGGA 1 cut(s) 223
Van91I CCANNNNNTGG 1 cut(s) 101
Vha464I CTTAAG 1 cut(s) 200
VpaK11BI GGWCC 1 cut(s) 181
XapI RAATTY 1 cut(s) 107
XspI CTAG 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.