Rmu_sc0007408.1_g000011

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007408.1
Physical Location & Seq
Reverse (-)
41606 .. 43055
1450 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007408.1_g000011.1.cds

Sequence Viewer

Length: 444 bp
atggatgtatcaccaccactgtcacctccatcaccagagacctctagcgatgaggacattggaagtacgaaagcagaagaacctgaagggattgagactgacgactctgaggaatcaaatcttgatgatttacctccagaacttgtccaacgcattagggagctagaagcacagattgcagctcaatatgaggaactcgtaaaagcacaaaggaaaaagatgtggttgcaagaaatcatcaatgcaatcagagagcgcataaggttaaggcaagctcaactactgcagcgatatttgcaagattcggatgatcaaaatgctcaactattgcaacgaaatttggaagattcggatgatcataatggtgatgactcaaatgccgaggacatggatgaggatgaggatgatgatgactcagatgataacgacgacaacgtgatgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

147

Amino Acids

16.83

Weight (kDa)

4.05

Isoelectric Point (pI)

74.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018447)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 337
AcuI CTGAAG 1 cut(s) 105
AfaI GTAC 1 cut(s) 67
AluBI AGCT 3 cut(s) 163, 182, 275
AluI AGCT 3 cut(s) 163, 182, 275
Alw26I GTCTC 2 cut(s) 32, 89
ApeKI GCWGC 2 cut(s) 179, 286
ApoI RAATTY 1 cut(s) 337
AspLEI GCGC 1 cut(s) 258
AsuHPI GGTGA 4 cut(s) 3, 15, 24, 377
BbvI GCAGC 2 cut(s) 191, 298
BccI CCATC 1 cut(s) 37
BclI TGATCA 2 cut(s) 310, 355
BcoDI GTCTC 2 cut(s) 32, 89
BfaI CTAG 2 cut(s) 45, 164
BfmI CTRYAG 1 cut(s) 284
BisI GCNGC 2 cut(s) 180, 287
BlsI GCNGC 2 cut(s) 181, 288
BpmI CTGGAG 1 cut(s) 120
BsaI GGTCTC 1 cut(s) 32
BsaJI CCNNGG 1 cut(s) 381
BseDI CCNNGG 1 cut(s) 381
BseGI GGATG 6 cut(s) 10, 313, 358, 397, 403, 409
BseMII CTCAG 2 cut(s) 99, 429
BseXI GCAGC 2 cut(s) 191, 298
BsmAI GTCTC 2 cut(s) 32, 89
Bso31I GGTCTC 1 cut(s) 32
Bsp143I GATC 2 cut(s) 310, 355
BspCNI CTCAG 2 cut(s) 100, 428
BspMAI CTGCAG 1 cut(s) 288
BspTNI GGTCTC 1 cut(s) 32
BssECI CCNNGG 1 cut(s) 381
BssMI GATC 2 cut(s) 310, 355
Bst4CI ACNGT 1 cut(s) 21
BstAPI GCANNNNNTGC 1 cut(s) 176
BstC8I GCNNGC 1 cut(s) 273
BstDEI CTNAG 2 cut(s) 108, 415
BstF5I GGATG 6 cut(s) 10, 313, 358, 397, 403, 409
BstHHI GCGC 1 cut(s) 258
BstKTI GATC 2 cut(s) 313, 358
BstMAI GTCTC 2 cut(s) 32, 89
BstMBI GATC 2 cut(s) 310, 355
BstMWI GCNNNNNNNGC 2 cut(s) 176, 295
BstSFI CTRYAG 1 cut(s) 284
BstV1I GCAGC 2 cut(s) 191, 298
BtgZI GCGATG 1 cut(s) 63
BtsCI GGATG 6 cut(s) 10, 313, 358, 397, 403, 409
BtsIMutI CAGTG 1 cut(s) 17
Cac8I GCNNGC 1 cut(s) 273
CfoI GCGC 1 cut(s) 258
Csp6I GTAC 1 cut(s) 66
CviAII CATG 1 cut(s) 388
CviJI RGCY 3 cut(s) 163, 182, 275
CviKI_1 RGCY 3 cut(s) 163, 182, 275
CviQI GTAC 1 cut(s) 66
DdeI CTNAG 2 cut(s) 108, 415
DpnI GATC 2 cut(s) 312, 357
DpnII GATC 2 cut(s) 310, 355
Eco31I GGTCTC 1 cut(s) 32
Eco57I CTGAAG 1 cut(s) 105
FaeI CATG 1 cut(s) 391
FaiI YATR 4 cut(s) 189, 260, 360, 389
FatI CATG 1 cut(s) 387
FbaI TGATCA 2 cut(s) 310, 355
Fnu4HI GCNGC 2 cut(s) 180, 287
FokI GGATG 6 cut(s) 17, 320, 365, 404, 410, 416
Fsp4HI GCNGC 2 cut(s) 180, 287
FspBI CTAG 2 cut(s) 45, 164
GlaI GCGC 1 cut(s) 257
GluI GCNGC 2 cut(s) 180, 287
GsuI CTGGAG 1 cut(s) 120
HhaI GCGC 1 cut(s) 258
Hin1II CATG 1 cut(s) 391
Hin6I GCGC 1 cut(s) 256
HinP1I GCGC 1 cut(s) 256
HinfI GANTC 6 cut(s) 104, 113, 302, 347, 371, 413
HphI GGTGA 4 cut(s) 3, 15, 24, 377
Hpy188I TCNGA 5 cut(s) 109, 251, 307, 352, 418
Hpy188III TCNNGA 2 cut(s) 122, 137
Hpy99I CGWCG 1 cut(s) 431
HpyAV CCTTC 1 cut(s) 80
HpyCH4III ACNGT 1 cut(s) 21
HpyCH4IV ACGT 1 cut(s) 435
HpyCH4V TGCA 6 cut(s) 179, 229, 245, 286, 298, 331
HpyF10VI GCNNNNNNNGC 2 cut(s) 176, 295
HpyF3I CTNAG 2 cut(s) 108, 415
HpySE526I ACGT 1 cut(s) 435
Hsp92II CATG 1 cut(s) 391
HspAI GCGC 1 cut(s) 256
Ksp22I TGATCA 2 cut(s) 310, 355
Kzo9I GATC 2 cut(s) 310, 355
LmnI GCTCC 1 cut(s) 160
LpnPI CCDG 3 cut(s) 48, 96, 150
Lsp1109I GCAGC 2 cut(s) 191, 298
MaeI CTAG 2 cut(s) 45, 164
MaeII ACGT 1 cut(s) 435
MaeIII GTNAC 1 cut(s) 21
MalI GATC 2 cut(s) 312, 357
MboI GATC 2 cut(s) 310, 355
MboII GAAGA 2 cut(s) 89, 356
MluCI AATT 1 cut(s) 337
MlyI GAGTC 3 cut(s) 98, 365, 407
MmeI TCCRAC 1 cut(s) 172
MnlI CCTC 9 cut(s) 36, 46, 52, 103, 144, 184, 376, 388, 394
MseI TTAA 1 cut(s) 266
MslI CAYNNNNRTG 1 cut(s) 363
MwoI GCNNNNNNNGC 2 cut(s) 176, 295
NdeII GATC 2 cut(s) 310, 355
NlaIII CATG 1 cut(s) 391
NmeAIII GCCGAG 1 cut(s) 406
NmuCI GTSAC 1 cut(s) 21
PcsI WCGNNNNNNNCGW 1 cut(s) 432
PfeI GAWTC 3 cut(s) 113, 302, 347
PkrI GCNGC 2 cut(s) 181, 288
PleI GAGTC 3 cut(s) 98, 365, 407
PpsI GAGTC 3 cut(s) 98, 365, 407
PstI CTGCAG 1 cut(s) 288
RsaI GTAC 1 cut(s) 67
RsaNI GTAC 1 cut(s) 66
RseI CAYNNNNRTG 1 cut(s) 363
SaqAI TTAA 1 cut(s) 266
SatI GCNGC 2 cut(s) 180, 287
Sau3AI GATC 2 cut(s) 310, 355
SchI GAGTC 3 cut(s) 98, 365, 407
SetI ASST 9 cut(s) 28, 44, 85, 136, 165, 184, 266, 277, 438
SfcI CTRYAG 1 cut(s) 284
SmiMI CAYNNNNRTG 1 cut(s) 363
Sse9I AATT 1 cut(s) 337
SspMI CTAG 2 cut(s) 45, 164
TaaI ACNGT 1 cut(s) 21
TaiI ACGT 1 cut(s) 438
TasI AATT 1 cut(s) 337
TfiI GAWTC 3 cut(s) 113, 302, 347
Tru1I TTAA 1 cut(s) 266
Tru9I TTAA 1 cut(s) 266
TscAI CASTG 1 cut(s) 24
TseFI GTSAC 1 cut(s) 21
TseI GCWGC 2 cut(s) 179, 286
Tsp45I GTSAC 1 cut(s) 21
TspRI CASTG 1 cut(s) 24
XapI RAATTY 1 cut(s) 337
XspI CTAG 2 cut(s) 45, 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.