Rh2DG336500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
43212292 .. 43212709
418 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG336500.1

Sequence Viewer

Length: 289 bp
ATGGATGTATCACCACCACTGGCACCTCCACCACTGTCACCTCCATCACCAGAGACCTCCAGCGATGAGGACATTGGAAGTACGAAAGCAGGAGAACCTGAAGCGATTGAGACTGACGACTCTGAGGAATCAAATCTTGATGATTTACCACCAGAACTTGTCCAACGCATTAGGGAGCTAGAAGCACGGATTGCAGCTCAATATGAGGAACTAGTAATAGCGCAAAGGAAAAAGATGTGGTTGCAAGAAATCATCAATGCAATCAGAGAGCGCATAATGTTAAGGCAAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

10.81

Weight (kDa)

4.29

Isoelectric Point (pI)

82.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018447)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 22
AcuI CTGAAG 1 cut(s) 120
AfaI GTAC 1 cut(s) 82
AhlI ACTAGT 1 cut(s) 211
AluBI AGCT 2 cut(s) 178, 197
AluI AGCT 2 cut(s) 178, 197
Alw26I GTCTC 2 cut(s) 47, 104
ApeKI GCWGC 1 cut(s) 194
AspLEI GCGC 2 cut(s) 223, 273
AsuHPI GGTGA 3 cut(s) 3, 30, 39
BanI GGYRCC 1 cut(s) 22
BbvI GCAGC 1 cut(s) 206
BccI CCATC 1 cut(s) 52
BcoDI GTCTC 2 cut(s) 47, 104
BcuI ACTAGT 1 cut(s) 211
BfaI CTAG 2 cut(s) 179, 212
BisI GCNGC 1 cut(s) 195
BlsI GCNGC 1 cut(s) 196
BmiI GGNNCC 1 cut(s) 24
BpmI CTGGAG 1 cut(s) 43
BsaI GGTCTC 1 cut(s) 47
Bse1I ACTGG 1 cut(s) 24
BseGI GGATG 1 cut(s) 10
BseMII CTCAG 1 cut(s) 114
BseNI ACTGG 1 cut(s) 24
BseXI GCAGC 1 cut(s) 206
BshNI GGYRCC 1 cut(s) 22
BsmAI GTCTC 2 cut(s) 47, 104
Bso31I GGTCTC 1 cut(s) 47
BspCNI CTCAG 1 cut(s) 115
BspLI GGNNCC 1 cut(s) 24
BspT107I GGYRCC 1 cut(s) 22
BspTNI GGTCTC 1 cut(s) 47
BsrI ACTGG 1 cut(s) 24
Bst4CI ACNGT 1 cut(s) 36
BstAPI GCANNNNNTGC 1 cut(s) 191
BstDEI CTNAG 1 cut(s) 123
BstF5I GGATG 1 cut(s) 10
BstHHI GCGC 2 cut(s) 223, 273
BstMAI GTCTC 2 cut(s) 47, 104
BstMWI GCNNNNNNNGC 1 cut(s) 191
BstV1I GCAGC 1 cut(s) 206
BtgZI GCGATG 1 cut(s) 78
BtsCI GGATG 1 cut(s) 10
BtsIMutI CAGTG 2 cut(s) 17, 32
CfoI GCGC 2 cut(s) 223, 273
Csp6I GTAC 1 cut(s) 81
CviJI RGCY 2 cut(s) 178, 197
CviKI_1 RGCY 2 cut(s) 178, 197
CviQI GTAC 1 cut(s) 81
DdeI CTNAG 1 cut(s) 123
Eco31I GGTCTC 1 cut(s) 47
Eco57I CTGAAG 1 cut(s) 120
FaiI YATR 2 cut(s) 204, 275
Fnu4HI GCNGC 1 cut(s) 195
FokI GGATG 1 cut(s) 17
Fsp4HI GCNGC 1 cut(s) 195
FspBI CTAG 2 cut(s) 179, 212
GlaI GCGC 2 cut(s) 222, 272
GluI GCNGC 1 cut(s) 195
GsuI CTGGAG 1 cut(s) 43
HhaI GCGC 2 cut(s) 223, 273
Hin6I GCGC 2 cut(s) 221, 271
HinP1I GCGC 2 cut(s) 221, 271
HinfI GANTC 2 cut(s) 119, 128
HphI GGTGA 3 cut(s) 3, 30, 39
Hpy188I TCNGA 2 cut(s) 124, 266
Hpy188III TCNNGA 1 cut(s) 137
HpyCH4III ACNGT 1 cut(s) 36
HpyCH4V TGCA 3 cut(s) 194, 244, 260
HpyF10VI GCNNNNNNNGC 1 cut(s) 191
HpyF3I CTNAG 1 cut(s) 123
HspAI GCGC 2 cut(s) 221, 271
LmnI GCTCC 1 cut(s) 175
LpnPI CCDG 6 cut(s) 5, 63, 73, 75, 111, 165
Lsp1109I GCAGC 1 cut(s) 206
MaeI CTAG 2 cut(s) 179, 212
MaeIII GTNAC 1 cut(s) 36
MlyI GAGTC 1 cut(s) 113
MmeI TCCRAC 1 cut(s) 187
MnlI CCTC 6 cut(s) 36, 51, 61, 67, 118, 199
MseI TTAA 1 cut(s) 281
MwoI GCNNNNNNNGC 1 cut(s) 191
NlaIV GGNNCC 1 cut(s) 24
NmuCI GTSAC 1 cut(s) 36
PfeI GAWTC 1 cut(s) 128
PkrI GCNGC 1 cut(s) 196
PleI GAGTC 1 cut(s) 113
PpsI GAGTC 1 cut(s) 113
PspN4I GGNNCC 1 cut(s) 24
RsaI GTAC 1 cut(s) 82
RsaNI GTAC 1 cut(s) 81
SaqAI TTAA 1 cut(s) 281
SatI GCNGC 1 cut(s) 195
SchI GAGTC 1 cut(s) 113
SetI ASST 6 cut(s) 28, 43, 59, 100, 180, 199
SpeI ACTAGT 1 cut(s) 211
SspMI CTAG 2 cut(s) 179, 212
TaaI ACNGT 1 cut(s) 36
TfiI GAWTC 1 cut(s) 128
Tru1I TTAA 1 cut(s) 281
Tru9I TTAA 1 cut(s) 281
TscAI CASTG 2 cut(s) 24, 39
TseFI GTSAC 1 cut(s) 36
TseI GCWGC 1 cut(s) 194
Tsp45I GTSAC 1 cut(s) 36
TspGWI ACGGA 1 cut(s) 202
TspRI CASTG 2 cut(s) 24, 39
XspI CTAG 2 cut(s) 179, 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.