Rroxscaffold_3G00235700

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
22793761 .. 22798904
5144 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00235700.1

Sequence Viewer

Length: 288 bp
ATGGATAATAACGAGAGCAGACTTACACTCGAGTGGTTGAAGGCCGAGTTCGTGTACAAGAGTCACATAACTTCTAAACAAATGGATTTATCACCACCATTGTCACCTCCACCACTGTCACCTCCATCACCAGAGACCTCCAGCGATGAGGACATTGGAAGTACGAAAGCAAGAGAACCTGAAGGCATTGAGATTGACGACTCGAGAAATCAAATCTTGATGATTTACTACCAGAACTTGTCCAACGCATTAGGGAGCGAGAAGCACAGATTGCAGCTCAATATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

95

Amino Acids

10.77

Weight (kDa)

4.74

Isoelectric Point (pI)

76.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018447)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 201
AfaI GTAC 2 cut(s) 56, 163
AgsI TTSAA 1 cut(s) 40
AleI CACNNNNGTG 1 cut(s) 31
AluBI AGCT 1 cut(s) 277
AluI AGCT 1 cut(s) 277
Alw26I GTCTC 1 cut(s) 128
Ama87I CYCGRG 2 cut(s) 29, 202
AoxI GGCC 1 cut(s) 42
ApeKI GCWGC 1 cut(s) 274
AsuHPI GGTGA 4 cut(s) 84, 96, 111, 120
AvaI CYCGRG 2 cut(s) 29, 202
BccI CCATC 1 cut(s) 133
BcoDI GTCTC 1 cut(s) 128
BisI GCNGC 1 cut(s) 275
BlsI GCNGC 1 cut(s) 276
BmeT110I CYCGRG 2 cut(s) 29, 202
BpmI CTGGAG 1 cut(s) 124
BsaI GGTCTC 1 cut(s) 128
BshFI GGCC 1 cut(s) 44
BsiHKCI CYCGRG 2 cut(s) 29, 202
BsmAI GTCTC 1 cut(s) 128
BsnI GGCC 1 cut(s) 44
Bso31I GGTCTC 1 cut(s) 128
BsoBI CYCGRG 2 cut(s) 29, 202
Bsp1407I TGTACA 1 cut(s) 54
BspANI GGCC 1 cut(s) 44
BspTNI GGTCTC 1 cut(s) 128
BsrGI TGTACA 1 cut(s) 54
Bst4CI ACNGT 1 cut(s) 117
BstAPI GCANNNNNTGC 1 cut(s) 271
BstAUI TGTACA 1 cut(s) 54
BstMAI GTCTC 1 cut(s) 128
BstMWI GCNNNNNNNGC 1 cut(s) 271
BsuRI GGCC 1 cut(s) 44
BtgZI GCGATG 1 cut(s) 159
BtsIMutI CAGTG 1 cut(s) 113
Csp6I GTAC 2 cut(s) 55, 162
CviJI RGCY 2 cut(s) 44, 277
CviKI_1 RGCY 2 cut(s) 44, 277
CviQI GTAC 2 cut(s) 55, 162
Eco31I GGTCTC 1 cut(s) 128
Eco57I CTGAAG 1 cut(s) 201
Eco88I CYCGRG 2 cut(s) 29, 202
FaiI YATR 2 cut(s) 68, 284
Fnu4HI GCNGC 1 cut(s) 275
Fsp4HI GCNGC 1 cut(s) 275
GluI GCNGC 1 cut(s) 275
GsuI CTGGAG 1 cut(s) 124
HaeIII GGCC 1 cut(s) 44
HinfI GANTC 2 cut(s) 61, 200
HphI GGTGA 4 cut(s) 84, 96, 111, 120
Hpy166II GTNNAC 1 cut(s) 55
Hpy188III TCNNGA 2 cut(s) 204, 217
Hpy8I GTNNAC 1 cut(s) 55
HpyAV CCTTC 2 cut(s) 34, 176
HpyCH4III ACNGT 1 cut(s) 117
HpyCH4V TGCA 1 cut(s) 274
HpyF10VI GCNNNNNNNGC 1 cut(s) 271
LmnI GCTCC 1 cut(s) 255
LpnPI CCDG 4 cut(s) 144, 154, 192, 245
MaeIII GTNAC 3 cut(s) 62, 102, 117
MlyI GAGTC 2 cut(s) 70, 194
MmeI TCCRAC 1 cut(s) 267
MnlI CCTC 4 cut(s) 117, 132, 142, 148
MslI CAYNNNNRTG 1 cut(s) 31
MwoI GCNNNNNNNGC 1 cut(s) 271
NmeAIII GCCGAG 1 cut(s) 70
NmuCI GTSAC 3 cut(s) 62, 102, 117
OliI CACNNNNGTG 1 cut(s) 31
PaeR7I CTCGAG 2 cut(s) 29, 202
PkrI GCNGC 1 cut(s) 276
PleI GAGTC 2 cut(s) 69, 194
PpsI GAGTC 2 cut(s) 69, 194
PspXI VCTCGAGB 1 cut(s) 29
RsaI GTAC 2 cut(s) 56, 163
RsaNI GTAC 2 cut(s) 55, 162
RseI CAYNNNNRTG 1 cut(s) 31
SatI GCNGC 1 cut(s) 275
SchI GAGTC 2 cut(s) 70, 194
SetI ASST 5 cut(s) 109, 124, 140, 181, 279
Sfr274I CTCGAG 2 cut(s) 29, 202
SlaI CTCGAG 2 cut(s) 29, 202
SmiMI CAYNNNNRTG 1 cut(s) 31
SmlI CTYRAG 2 cut(s) 29, 202
SmoI CTYRAG 2 cut(s) 29, 202
TaaI ACNGT 1 cut(s) 117
TaqI TCGA 2 cut(s) 30, 203
TatI WGTACW 1 cut(s) 54
TscAI CASTG 1 cut(s) 120
TseFI GTSAC 3 cut(s) 62, 102, 117
TseI GCWGC 1 cut(s) 274
Tsp45I GTSAC 3 cut(s) 62, 102, 117
TspRI CASTG 1 cut(s) 120
XhoI CTCGAG 2 cut(s) 29, 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.