FvH4_5g30630
NAC Family

inactive receptor kinase

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
Physical Location & Seq
Forward (+)
21517749 .. 21517985
237 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g30630.t1

Sequence Viewer

Length: 237 bp
ATGTTCAGCTCAACTCCCACCTGGATTCTCACCTTGGTCTTGTTCTTGAGCTTCTTCTCATCCTACCAAGCTGTTGTGGAAGACGACGTCAAGTGCCTTCAGGGGATTAAAGAAGCTTTCAAGGACCCTCTTGGGAAGCTCAAGTCTTGGGACTTCTCCAACTCCTCTGTGGTCGTCTGCCACTTTGTGGGTGTTTCTTGCTGGAACGATTGCGAGAATCGAATCTACAATCTCTAG

Protein Analysis

79

Amino Acids

8.91

Weight (kDa)

5.04

Isoelectric Point (pI)

28.79

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRRNT_2 PF08263 27 - 68 1.2e-10 Leucine rich repeat N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018799)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 90
AccB7I CCANNNNNTGG 1 cut(s) 187
AcuI CTGAAG 1 cut(s) 83
AcyI GRCGYC 1 cut(s) 87
AdeI CACNNNGTG 1 cut(s) 187
AfiI CCNNNNNNNGG 1 cut(s) 187
AgsI TTSAA 1 cut(s) 121
AjnI CCWGG 1 cut(s) 20
AluBI AGCT 5 cut(s) 9, 51, 71, 116, 139
AluI AGCT 5 cut(s) 9, 51, 71, 116, 139
AspS9I GGNCC 1 cut(s) 124
AsuHPI GGTGA 1 cut(s) 22
AvaII GGWCC 1 cut(s) 124
BbsI GAAGAC 1 cut(s) 87
BciT130I CCWGG 1 cut(s) 22
BfaI CTAG 1 cut(s) 235
Bme1390I CCNGG 1 cut(s) 22
Bme18I GGWCC 1 cut(s) 124
BmgT120I GGNCC 1 cut(s) 124
BmiI GGNNCC 1 cut(s) 126
BmrFI CCNGG 1 cut(s) 22
BpiI GAAGAC 1 cut(s) 87
BpuEI CTTGAG 2 cut(s) 67, 125
BsaHI GRCGYC 1 cut(s) 87
BsaJI CCNNGG 1 cut(s) 33
Bsc4I CCNNNNNNNGG 1 cut(s) 187
BseBI CCWGG 1 cut(s) 22
BseDI CCNNGG 1 cut(s) 33
BseGI GGATG 1 cut(s) 59
BseLI CCNNNNNNNGG 1 cut(s) 187
BseRI GAGGAG 1 cut(s) 154
BslFI GGGAC 1 cut(s) 164
BslI CCNNNNNNNGG 1 cut(s) 187
BsmFI GGGAC 1 cut(s) 164
BspLI GGNNCC 1 cut(s) 126
BssECI CCNNGG 1 cut(s) 33
BssNI GRCGYC 1 cut(s) 87
BssT1I CCWWGG 1 cut(s) 33
Bst2UI CCWGG 1 cut(s) 22
BstACI GRCGYC 1 cut(s) 87
BstF5I GGATG 1 cut(s) 59
BstNI CCWGG 1 cut(s) 22
BstSCI CCNGG 1 cut(s) 20
BstV2I GAAGAC 1 cut(s) 87
BtsCI GGATG 1 cut(s) 59
Cfr13I GGNCC 1 cut(s) 124
CviJI RGCY 5 cut(s) 9, 51, 71, 116, 139
CviKI_1 RGCY 5 cut(s) 9, 51, 71, 116, 139
DraIII CACNNNGTG 1 cut(s) 187
Eco130I CCWWGG 1 cut(s) 33
Eco47I GGWCC 1 cut(s) 124
Eco57I CTGAAG 1 cut(s) 83
EcoO109I RGGNCCY 1 cut(s) 124
EcoRII CCWGG 1 cut(s) 20
EcoT14I CCWWGG 1 cut(s) 33
ErhI CCWWGG 1 cut(s) 33
FaqI GGGAC 1 cut(s) 164
FokI GGATG 1 cut(s) 46
FspBI CTAG 1 cut(s) 235
Hin1I GRCGYC 1 cut(s) 87
HindIII AAGCTT 1 cut(s) 114
HinfI GANTC 3 cut(s) 25, 217, 222
HphI GGTGA 1 cut(s) 22
Hpy188III TCNNGA 1 cut(s) 46
Hpy99I CGWCG 1 cut(s) 89
HpyAV CCTTC 1 cut(s) 107
HpyCH4IV ACGT 1 cut(s) 87
HpySE526I ACGT 1 cut(s) 87
Hsp92I GRCGYC 1 cut(s) 87
LpnPI CCDG 4 cut(s) 7, 34, 86, 187
MaeI CTAG 1 cut(s) 235
MaeII ACGT 1 cut(s) 87
MboII GAAGA 2 cut(s) 46, 92
MmeI TCCRAC 1 cut(s) 183
MnlI CCTC 2 cut(s) 138, 175
MseI TTAA 1 cut(s) 108
MspR9I CCNGG 1 cut(s) 22
MvaI CCWGG 1 cut(s) 22
NlaIV GGNNCC 1 cut(s) 126
PfeI GAWTC 3 cut(s) 25, 217, 222
PflFI GACNNNGTC 1 cut(s) 86
PflMI CCANNNNNTGG 1 cut(s) 187
PpuMI RGGWCCY 1 cut(s) 124
Psp5II RGGWCCY 1 cut(s) 124
Psp6I CCWGG 1 cut(s) 20
PspGI CCWGG 1 cut(s) 20
PspN4I GGNNCC 1 cut(s) 126
PspPI GGNCC 1 cut(s) 124
PspPPI RGGWCCY 1 cut(s) 124
PsyI GACNNNGTC 1 cut(s) 86
SaqAI TTAA 1 cut(s) 108
Sau96I GGNCC 1 cut(s) 124
ScrFI CCNGG 1 cut(s) 22
SetI ASST 8 cut(s) 11, 23, 35, 53, 73, 90, 118, 141
SinI GGWCC 1 cut(s) 124
SmlI CTYRAG 2 cut(s) 46, 140
SmoI CTYRAG 2 cut(s) 46, 140
SspMI CTAG 1 cut(s) 235
StyD4I CCNGG 1 cut(s) 20
StyI CCWWGG 1 cut(s) 33
TaiI ACGT 1 cut(s) 90
TaqI TCGA 1 cut(s) 220
TfiI GAWTC 3 cut(s) 25, 217, 222
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
Tth111I GACNNNGTC 1 cut(s) 86
Van91I CCANNNNNTGG 1 cut(s) 187
VpaK11BI GGWCC 1 cut(s) 124
XcmI CCANNNNNNNNNTGG 1 cut(s) 166
XspI CTAG 1 cut(s) 235
ZraI GACGTC 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.