Basic Information

Type: gene

Biological Identity

Species

fragaria_vesca

Chromosome

Fvb6

Orthogroup ID

OG0018355

Physical Location & Seq

Genomic Coordinates Forward (+)

11545837 .. 11546774

Gene Structure 938 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

FvH4_6g17651.t1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 597 bp

ATGGTCTTACGACAACTTTTAGTCAAATGGTGGGATAAATTCAATTCTGAAAGAGTTTTATCCCAATTCAGTGAAGAATTTTCAGTTATTCCATCCACTTCAAGAGCTTCAGTCTTTATTCAGCCAACATCTCCGATCCCCCAGTTAAAGTCTCAGACTCCTCAGTCACCATCCTCTTCTAAGAAAATAGTCTCCAGTTCATCCTCATCCTCCAAAGCAGATGAATTAAAAGAATTGGCCAAACAATTACTACAACAGGCGGCCAGTTTATCCACAGATGATGAAGGAGAACACTCTCCATCAGGATCTTCATCAGCTCATAGTCATCAAGGTTTTCCCAGTCAAACAACCAGGTGGGCCGATTATGAAGATAGTCAAGATCCATATGCTGAGGACTTTAATATGGCTGATCTTACTTTTGGACCAGTCTTGACTAAAACTAAACAAACTCAGCATATGTATCTTGACTATCTTCATAATCGGCCCACCTGGTTGGTTGACTGGGAAAACCTTGATGACTATGAGCTGATGACGATTCTGATGGAGAGTGATGAGGATGAAGTGAAGACTATTTTCTTAGAAGAGGATGGTGACTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00010 ko00020 ko00620 ko01100 ko01110 ko01120 ko01130 ko01200 map00010 map00020 map00620 map01100 map01110 map01120 map01130 map01200

Pfam Domains

Protein Families

2-oxoacid_dh Biotin_lipoyl E3_binding

Protein Analysis

199

Amino Acids

22.48

Weight (kDa)

4.52

Isoelectric Point (pI)

61.94

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018355)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g20301 FvH4_6g17651
rosa_multiflora	Rmu_sc0000235.1_g000027 Rmu_sc0000235.1_g000029 Rmu_sc0000607.1_g000043 Rmu_sc0001460.1_g000015 Rmu_sc0002026.1_g000015 Rmu_sc0002563.1_g000050 Rmu_sc0004080.1_g000012 Rmu_sc0007727.1_g000020

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	163
AciI	CCGC	1 cut(s)	260
AclWI	GGATC	3 cut(s)	130, 313, 374
AcoI	YGGCCR	2 cut(s)	237, 261
AcsI	RAATTY	2 cut(s)	38, 77
AcuI	CTGAAG	1 cut(s)	93
AgsI	TTSAA	2 cut(s)	43, 102
AjnI	CCWGG	2 cut(s)	350, 488
AluBI	AGCT	3 cut(s)	107, 317, 526
AluI	AGCT	3 cut(s)	107, 317, 526
Alw26I	GTCTC	2 cut(s)	156, 196
AlwI	GGATC	3 cut(s)	130, 313, 374
AoxI	GGCC	4 cut(s)	237, 261, 357, 482
ApoI	RAATTY	2 cut(s)	38, 77
AspS9I	GGNCC	3 cut(s)	357, 422, 483
AsuHPI	GGTGA	1 cut(s)	159
AvaII	GGWCC	1 cut(s)	422
BalI	TGGCCA	1 cut(s)	239
BbsI	GAAGAC	1 cut(s)	572
BbvCI	CCTCAGC	1 cut(s)	390
BccI	CCATC	5 cut(s)	100, 178, 307, 535, 581
BciT130I	CCWGG	2 cut(s)	352, 490
BcoDI	GTCTC	2 cut(s)	156, 196
BisI	GCNGC	1 cut(s)	261
BlsI	GCNGC	1 cut(s)	262
Bme1390I	CCNGG	2 cut(s)	352, 490
Bme18I	GGWCC	1 cut(s)	422
BmgT120I	GGNCC	3 cut(s)	357, 422, 483
BmrFI	CCNGG	2 cut(s)	352, 490
BmrI	ACTGGG	3 cut(s)	136, 333, 511
BmuI	ACTGGG	3 cut(s)	136, 333, 511
BpiI	GAAGAC	1 cut(s)	572
BpmI	CTGGAG	1 cut(s)	178
Bpu10I	CCTNAGC	1 cut(s)	390
BsaBI	GATNNNNATC	1 cut(s)	310
Bse1I	ACTGG	6 cut(s)	142, 195, 264, 339, 425, 506
Bse8I	GATNNNNATC	1 cut(s)	310
BseBI	CCWGG	2 cut(s)	352, 490
BseGI	GGATG	6 cut(s)	92, 170, 200, 206, 562, 592
BseJI	GATNNNNATC	1 cut(s)	310
BseMII	CTCAG	4 cut(s)	167, 176, 381, 464
BseNI	ACTGG	6 cut(s)	142, 195, 264, 339, 425, 506
BseRI	GAGGAG	1 cut(s)	150
BshFI	GGCC	4 cut(s)	239, 263, 359, 484
BsmAI	GTCTC	2 cut(s)	156, 196
BsnI	GGCC	4 cut(s)	239, 263, 359, 484
Bsp143I	GATC	4 cut(s)	135, 305, 379, 409
BspACI	CCGC	1 cut(s)	260
BspANI	GGCC	4 cut(s)	239, 263, 359, 484
BspCNI	CTCAG	4 cut(s)	166, 175, 382, 463
BspPI	GGATC	3 cut(s)	130, 313, 374
BsrI	ACTGG	6 cut(s)	142, 195, 264, 339, 425, 506
BssMI	GATC	4 cut(s)	135, 305, 379, 409
Bst2UI	CCWGG	2 cut(s)	352, 490
Bst6I	CTCTTC	2 cut(s)	181, 576
BstDEI	CTNAG	6 cut(s)	153, 162, 180, 390, 450, 577
BstF5I	GGATG	6 cut(s)	92, 170, 200, 206, 562, 592
BstKTI	GATC	4 cut(s)	138, 308, 382, 412
BstMAI	GTCTC	2 cut(s)	156, 196
BstMBI	GATC	4 cut(s)	135, 305, 379, 409
BstNI	CCWGG	2 cut(s)	352, 490
BstSCI	CCNGG	2 cut(s)	350, 488
BstV2I	GAAGAC	1 cut(s)	572
BstX2I	RGATCY	2 cut(s)	305, 379
BstXI	CCANNNNNNTGG	1 cut(s)	493
BstYI	RGATCY	2 cut(s)	305, 379
BsuRI	GGCC	4 cut(s)	239, 263, 359, 484
BtsCI	GGATG	6 cut(s)	92, 170, 200, 206, 562, 592
BtsIMutI	CAGTG	1 cut(s)	76
Cfr13I	GGNCC	3 cut(s)	357, 422, 483
CsiI	ACCWGGT	2 cut(s)	350, 488
CviJI	RGCY	9 cut(s)	107, 124, 239, 263, 317, 359, 407, 484, 526
CviKI_1	RGCY	9 cut(s)	107, 124, 239, 263, 317, 359, 407, 484, 526
DdeI	CTNAG	6 cut(s)	153, 162, 180, 390, 450, 577
DpnI	GATC	4 cut(s)	137, 307, 381, 411
DpnII	GATC	4 cut(s)	135, 305, 379, 409
DrdI	GACNNNNNNGTC	1 cut(s)	163
DseDI	GACNNNNNNGTC	1 cut(s)	163
EaeI	YGGCCR	2 cut(s)	237, 261
Eam1104I	CTCTTC	2 cut(s)	181, 576
EarI	CTCTTC	2 cut(s)	181, 576
Eco47I	GGWCC	1 cut(s)	422
Eco57I	CTGAAG	1 cut(s)	93
EcoRII	CCWGG	2 cut(s)	350, 488
FaiI	YATR	9 cut(s)	321, 366, 385, 387, 404, 456, 458, 477, 522
FauNDI	CATATG	2 cut(s)	385, 456
Fnu4HI	GCNGC	1 cut(s)	261
FokI	GGATG	5 cut(s)	79, 157, 187, 193, 569
Fsp4HI	GCNGC	1 cut(s)	261
GluI	GCNGC	1 cut(s)	261
GsuI	CTGGAG	1 cut(s)	178
HaeIII	GGCC	4 cut(s)	239, 263, 359, 484
HincII	GTYRAC	1 cut(s)	499
HindII	GTYRAC	1 cut(s)	499
HinfI	GANTC	2 cut(s)	157, 535
HphI	GGTGA	1 cut(s)	159
Hpy166II	GTNNAC	1 cut(s)	499
Hpy188I	TCNGA	4 cut(s)	49, 135, 156, 540
Hpy188III	TCNNGA	5 cut(s)	102, 303, 377, 430, 464
Hpy8I	GTNNAC	1 cut(s)	499
HpyAV	CCTTC	1 cut(s)	278
HpyF3I	CTNAG	6 cut(s)	153, 162, 180, 390, 450, 577
Kzo9I	GATC	4 cut(s)	135, 305, 379, 409
MabI	ACCWGGT	2 cut(s)	350, 488
MaeIII	GTNAC	2 cut(s)	165, 590
MalI	GATC	4 cut(s)	137, 307, 381, 411
MboI	GATC	4 cut(s)	135, 305, 379, 409
MboII	GAAGA	7 cut(s)	86, 168, 300, 380, 464, 577, 593
MflI	RGATCY	2 cut(s)	305, 379
MlsI	TGGCCA	1 cut(s)	239
MluCI	AATT	7 cut(s)	38, 43, 65, 77, 224, 233, 245
MluNI	TGGCCA	1 cut(s)	239
MlyI	GAGTC	1 cut(s)	151
MnlI	CCTC	7 cut(s)	171, 184, 214, 220, 385, 547, 577
Mox20I	TGGCCA	1 cut(s)	239
MscI	TGGCCA	1 cut(s)	239
MseI	TTAA	3 cut(s)	146, 227, 399
Msp20I	TGGCCA	1 cut(s)	239
MspR9I	CCNGG	2 cut(s)	352, 490
MvaI	CCWGG	2 cut(s)	352, 490
NdeI	CATATG	2 cut(s)	385, 456
NdeII	GATC	4 cut(s)	135, 305, 379, 409
NmuCI	GTSAC	2 cut(s)	165, 590
PfeI	GAWTC	1 cut(s)	535
PkrI	GCNGC	1 cut(s)	262
PleI	GAGTC	1 cut(s)	151
PpsI	GAGTC	1 cut(s)	151
Psp6I	CCWGG	2 cut(s)	350, 488
PspGI	CCWGG	2 cut(s)	350, 488
PspPI	GGNCC	3 cut(s)	357, 422, 483
PsuI	RGATCY	2 cut(s)	305, 379
SaqAI	TTAA	3 cut(s)	146, 227, 399
SatI	GCNGC	1 cut(s)	261
Sau3AI	GATC	4 cut(s)	135, 305, 379, 409
Sau96I	GGNCC	3 cut(s)	357, 422, 483
SchI	GAGTC	1 cut(s)	151
ScrFI	CCNGG	2 cut(s)	352, 490
SetI	ASST	7 cut(s)	109, 319, 334, 356, 491, 513, 528
SexAI	ACCWGGT	2 cut(s)	350, 488
SinI	GGWCC	1 cut(s)	422
Sse9I	AATT	7 cut(s)	38, 43, 65, 77, 224, 233, 245
SsiI	CCGC	1 cut(s)	260
StyD4I	CCNGG	2 cut(s)	350, 488
TasI	AATT	7 cut(s)	38, 43, 65, 77, 224, 233, 245
TauI	GCSGC	1 cut(s)	263
TfiI	GAWTC	1 cut(s)	535
Tru1I	TTAA	3 cut(s)	146, 227, 399
Tru9I	TTAA	3 cut(s)	146, 227, 399
TscAI	CASTG	1 cut(s)	76
TseFI	GTSAC	2 cut(s)	165, 590
Tsp45I	GTSAC	2 cut(s)	165, 590
TspDTI	ATGAA	7 cut(s)	189, 237, 297, 300, 381, 464, 573
TspRI	CASTG	1 cut(s)	76
VpaK11BI	GGWCC	1 cut(s)	422
XapI	RAATTY	2 cut(s)	38, 77

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.