FvH4_6g27240

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
Physical Location & Seq
Reverse (-)
20904615 .. 20904977
363 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g27240.t1

Sequence Viewer

Length: 363 bp
ATGGAGGCCATTGCTTGCTATGACCAGGTCCACAGCAACAAAGAAAACATCCCTCCATTGTTCTCTGCAATTGCAAACTCGACCAACCCATTTCCGCTAATCAGGTCGTCGTTGTCGTCTGGGTCTTGGAAGAAGAAATGTAAGAAACTAAGGTCGAGGAGGAAGCCTCTTGCTGACATTACGAATCTCTACCTCTGGCAATACCAACTCATCAACACCAATTCACTCCCACCAAATCCAAGAGCAACTACGCCTCCCTCCTCCTCTGCCTCAAATCCTAGAAAACGGAAAGCTATTCAGGAGGCCAATATCCAAGACACCTGCAGCTCCAAATCCAAGTCGCTAAGGATGGGTTTCAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

121

Amino Acids

13.49

Weight (kDa)

10.38

Isoelectric Point (pI)

57.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 329
Acc36I ACCTGC 1 cut(s) 329
AciI CCGC 1 cut(s) 95
AjnI CCWGG 1 cut(s) 24
AluBI AGCT 2 cut(s) 293, 327
AluI AGCT 2 cut(s) 293, 327
AoxI GGCC 2 cut(s) 6, 303
ApeKI GCWGC 1 cut(s) 324
AspS9I GGNCC 1 cut(s) 28
AvaII GGWCC 1 cut(s) 28
BbvI GCAGC 1 cut(s) 336
BccI CCATC 1 cut(s) 343
BciT130I CCWGG 1 cut(s) 26
BfaI CTAG 1 cut(s) 279
BfmI CTRYAG 1 cut(s) 322
BfuAI ACCTGC 1 cut(s) 329
BisI GCNGC 1 cut(s) 325
BlsI GCNGC 1 cut(s) 326
Bme1390I CCNGG 1 cut(s) 26
Bme18I GGWCC 1 cut(s) 28
BmgT120I GGNCC 1 cut(s) 28
BmrFI CCNGG 1 cut(s) 26
BplI GAGNNNNNCTC 2 cut(s) 151, 183
Bpu10I CCTNAGC 1 cut(s) 344
BsaXI ACNNNNNCTCC 2 cut(s) 238, 268
Bse3DI GCAATG 1 cut(s) 9
BseBI CCWGG 1 cut(s) 26
BseGI GGATG 2 cut(s) 48, 354
BseMI GCAATG 1 cut(s) 9
BseRI GAGGAG 3 cut(s) 172, 250, 253
BseXI GCAGC 1 cut(s) 336
BshFI GGCC 2 cut(s) 8, 305
BsnI GGCC 2 cut(s) 8, 305
BspACI CCGC 1 cut(s) 95
BspANI GGCC 2 cut(s) 8, 305
BspMAI CTGCAG 1 cut(s) 326
BspMI ACCTGC 1 cut(s) 329
BsrDI GCAATG 1 cut(s) 9
Bst2UI CCWGG 1 cut(s) 26
BstC8I GCNNGC 1 cut(s) 16
BstDEI CTNAG 2 cut(s) 149, 344
BstF5I GGATG 2 cut(s) 48, 354
BstNI CCWGG 1 cut(s) 26
BstSCI CCNGG 1 cut(s) 24
BstSFI CTRYAG 1 cut(s) 322
BstV1I GCAGC 1 cut(s) 336
BsuRI GGCC 2 cut(s) 8, 305
BtsCI GGATG 2 cut(s) 48, 354
BveI ACCTGC 1 cut(s) 329
Cac8I GCNNGC 1 cut(s) 16
Cfr13I GGNCC 1 cut(s) 28
CsiI ACCWGGT 1 cut(s) 24
CviJI RGCY 5 cut(s) 8, 166, 293, 305, 327
CviKI_1 RGCY 5 cut(s) 8, 166, 293, 305, 327
DdeI CTNAG 2 cut(s) 149, 344
Eco47I GGWCC 1 cut(s) 28
EcoRII CCWGG 1 cut(s) 24
FaiI YATR 1 cut(s) 21
Fnu4HI GCNGC 1 cut(s) 325
FokI GGATG 1 cut(s) 35
Fsp4HI GCNGC 1 cut(s) 325
FspBI CTAG 1 cut(s) 279
GluI GCNGC 1 cut(s) 325
HaeIII GGCC 2 cut(s) 8, 305
HinfI GANTC 1 cut(s) 184
Hpy166II GTNNAC 1 cut(s) 31
Hpy188I TCNGA 1 cut(s) 359
Hpy188III TCNNGA 1 cut(s) 299
Hpy8I GTNNAC 1 cut(s) 31
Hpy99I CGWCG 1 cut(s) 112
HpyCH4V TGCA 3 cut(s) 68, 74, 324
HpyF3I CTNAG 2 cut(s) 149, 344
LmnI GCTCC 1 cut(s) 332
LpnPI CCDG 7 cut(s) 11, 38, 88, 105, 181, 284, 334
Lsp1109I GCAGC 1 cut(s) 336
MabI ACCWGGT 1 cut(s) 24
MaeI CTAG 1 cut(s) 279
MboII GAAGA 2 cut(s) 142, 145
MfeI CAATTG 1 cut(s) 69
MluCI AATT 2 cut(s) 69, 220
MspR9I CCNGG 1 cut(s) 26
MunI CAATTG 1 cut(s) 69
MvaI CCWGG 1 cut(s) 26
PaqCI CACCTGC 1 cut(s) 329
PcsI WCGNNNNNNNCGW 1 cut(s) 113
PfeI GAWTC 1 cut(s) 184
PflFI GACNNNGTC 1 cut(s) 26
PkrI GCNGC 1 cut(s) 326
Psp6I CCWGG 1 cut(s) 24
PspGI CCWGG 1 cut(s) 24
PspPI GGNCC 1 cut(s) 28
PstI CTGCAG 1 cut(s) 326
PsyI GACNNNGTC 1 cut(s) 26
SatI GCNGC 1 cut(s) 325
Sau96I GGNCC 1 cut(s) 28
ScrFI CCNGG 1 cut(s) 26
SetI ASST 7 cut(s) 30, 107, 155, 195, 295, 323, 329
SexAI ACCWGGT 1 cut(s) 24
SfcI CTRYAG 1 cut(s) 322
SinI GGWCC 1 cut(s) 28
Sse9I AATT 2 cut(s) 69, 220
SsiI CCGC 1 cut(s) 95
SspMI CTAG 1 cut(s) 279
StyD4I CCNGG 1 cut(s) 24
TaqI TCGA 2 cut(s) 80, 155
TasI AATT 2 cut(s) 69, 220
TfiI GAWTC 1 cut(s) 184
TseI GCWGC 1 cut(s) 324
TspGWI ACGGA 1 cut(s) 301
Tth111I GACNNNGTC 1 cut(s) 26
VpaK11BI GGWCC 1 cut(s) 28
XspI CTAG 1 cut(s) 279
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.