RLG00000019074

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr4
Physical Location & Seq
Reverse (-)
45950377 .. 45950760
384 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000019074

Sequence Viewer

Length: 384 bp
ATGGAGGCCATCGCTTGCTGTGACCAGGTCCACAGCAACAAAGAGAACATCCCCCCATTGCTCTCTGCAATTACAAAGTCGACGAACCCATTTCCTCAAACTGGGTCGTTGTCGTTGTCGTCGTCGTCGTCTGGGTCTTGGAAGAAGAAATGTAAGAAACTAAGGTCGAGGAGGAAGCCTCTTGCTGACATTACCAACCTCTACCTCTGGCGATACCAATTCAACACCAATGCACTCCAACCAAGTCCAAGAGTAACTATTACTCCCTCCTCTGCCTCAAATACTAGAAAAAGGAAAGCAATTCAGGAGCCCAATAGTAATACTACCACCATTCAAGTCACCAGTTCTTCCAAATCCAAGTCCCTAAGGATGGGTTTCCGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

128

Amino Acids

14.12

Weight (kDa)

10.69

Isoelectric Point (pI)

54.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 80
AfiI CCNNNNNNNGG 2 cut(s) 101, 370
AgsI TTSAA 2 cut(s) 223, 335
AjnI CCWGG 1 cut(s) 24
AoxI GGCC 1 cut(s) 6
AspS9I GGNCC 1 cut(s) 28
AsuHPI GGTGA 1 cut(s) 331
AvaII GGWCC 1 cut(s) 28
AxyI CCTNAGG 1 cut(s) 365
BanII GRGCYC 1 cut(s) 312
BccI CCATC 2 cut(s) 17, 364
BciT130I CCWGG 1 cut(s) 26
BfaI CTAG 1 cut(s) 285
Bme1390I CCNGG 1 cut(s) 26
Bme18I GGWCC 1 cut(s) 28
BmgT120I GGNCC 1 cut(s) 28
BmiI GGNNCC 1 cut(s) 309
BmrFI CCNGG 1 cut(s) 26
BmrI ACTGGG 1 cut(s) 111
BmuI ACTGGG 1 cut(s) 111
BplI GAGNNNNNCTC 2 cut(s) 163, 195
BsaXI ACNNNNNCTCC 2 cut(s) 247, 277
Bsc4I CCNNNNNNNGG 2 cut(s) 101, 370
Bse1I ACTGG 2 cut(s) 106, 342
Bse21I CCTNAGG 1 cut(s) 365
Bse3DI GCAATG 1 cut(s) 56
BseBI CCWGG 1 cut(s) 26
BseGI GGATG 2 cut(s) 48, 375
BseLI CCNNNNNNNGG 2 cut(s) 101, 370
BseMI GCAATG 1 cut(s) 56
BseNI ACTGG 2 cut(s) 106, 342
BseRI GAGGAG 2 cut(s) 184, 259
BshFI GGCC 1 cut(s) 8
BslFI GGGAC 1 cut(s) 346
BslI CCNNNNNNNGG 2 cut(s) 101, 370
BsmFI GGGAC 1 cut(s) 346
BsnI GGCC 1 cut(s) 8
Bsp1286I GDGCHC 1 cut(s) 312
BspANI GGCC 1 cut(s) 8
BspLI GGNNCC 1 cut(s) 309
BsrDI GCAATG 1 cut(s) 56
BsrI ACTGG 2 cut(s) 106, 342
Bst2UI CCWGG 1 cut(s) 26
BstC8I GCNNGC 1 cut(s) 16
BstDEI CTNAG 2 cut(s) 161, 365
BstF5I GGATG 2 cut(s) 48, 375
BstNI CCWGG 1 cut(s) 26
BstSCI CCNGG 1 cut(s) 24
Bsu36I CCTNAGG 1 cut(s) 365
BsuRI GGCC 1 cut(s) 8
BtsCI GGATG 2 cut(s) 48, 375
Cac8I GCNNGC 1 cut(s) 16
Cfr13I GGNCC 1 cut(s) 28
CsiI ACCWGGT 1 cut(s) 24
CviJI RGCY 3 cut(s) 8, 178, 310
CviKI_1 RGCY 3 cut(s) 8, 178, 310
DdeI CTNAG 2 cut(s) 161, 365
Eco24I GRGCYC 1 cut(s) 312
Eco47I GGWCC 1 cut(s) 28
Eco81I CCTNAGG 1 cut(s) 365
EcoRII CCWGG 1 cut(s) 24
EcoT38I GRGCYC 1 cut(s) 312
FaqI GGGAC 1 cut(s) 346
FblI GTMKAC 1 cut(s) 80
FokI GGATG 1 cut(s) 35
FriOI GRGCYC 1 cut(s) 312
FspBI CTAG 1 cut(s) 285
HaeIII GGCC 1 cut(s) 8
HincII GTYRAC 1 cut(s) 81
HindII GTYRAC 1 cut(s) 81
HphI GGTGA 1 cut(s) 331
Hpy166II GTNNAC 2 cut(s) 31, 81
Hpy188I TCNGA 1 cut(s) 380
Hpy188III TCNNGA 1 cut(s) 305
Hpy8I GTNNAC 2 cut(s) 31, 81
Hpy99I CGWCG 4 cut(s) 85, 124, 127, 130
HpyCH4V TGCA 2 cut(s) 68, 233
HpyF3I CTNAG 2 cut(s) 161, 365
LmnI GCTCC 1 cut(s) 307
LpnPI CCDG 7 cut(s) 11, 38, 87, 117, 193, 290, 355
MabI ACCWGGT 1 cut(s) 24
MaeI CTAG 1 cut(s) 285
MaeIII GTNAC 3 cut(s) 20, 253, 337
MboII GAAGA 3 cut(s) 154, 157, 339
MhlI GDGCHC 1 cut(s) 312
MluCI AATT 3 cut(s) 69, 218, 300
MmeI TCCRAC 1 cut(s) 262
MnlI CCTC 9 cut(s) 105, 162, 165, 189, 209, 215, 277, 280, 286
MspR9I CCNGG 1 cut(s) 26
MvaI CCWGG 1 cut(s) 26
NlaIV GGNNCC 1 cut(s) 309
NmuCI GTSAC 2 cut(s) 20, 337
PcsI WCGNNNNNNNCGW 2 cut(s) 119, 125
PflFI GACNNNGTC 1 cut(s) 26
Psp6I CCWGG 1 cut(s) 24
PspGI CCWGG 1 cut(s) 24
PspN4I GGNNCC 1 cut(s) 309
PspPI GGNCC 1 cut(s) 28
PsyI GACNNNGTC 1 cut(s) 26
SalI GTCGAC 1 cut(s) 79
Sau96I GGNCC 1 cut(s) 28
ScrFI CCNGG 1 cut(s) 26
SduI GDGCHC 1 cut(s) 312
SetI ASST 4 cut(s) 30, 167, 201, 207
SexAI ACCWGGT 1 cut(s) 24
SinI GGWCC 1 cut(s) 28
Sse9I AATT 3 cut(s) 69, 218, 300
SspMI CTAG 1 cut(s) 285
StyD4I CCNGG 1 cut(s) 24
TaqI TCGA 2 cut(s) 80, 167
TasI AATT 3 cut(s) 69, 218, 300
TseFI GTSAC 2 cut(s) 20, 337
Tsp45I GTSAC 2 cut(s) 20, 337
Tth111I GACNNNGTC 1 cut(s) 26
VpaK11BI GGWCC 1 cut(s) 28
XmiI GTMKAC 1 cut(s) 80
XspI CTAG 1 cut(s) 285
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.