Rw0G002970

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Contig00094
Physical Location & Seq
Reverse (-)
63968 .. 64339
372 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw0G002970.1

Sequence Viewer

Length: 372 bp
ATGGAGGCCATTGCTTGCTGTGACCAGGTCCACAGCAACAAAGAGAACATCCCCCCATTGTTCTCTGCAATTACAAAGTCGACGAACCCATTTCCTCAAACTGGGTCGTTGTCGTCGTCGTCTGGGTCTTGGAAGAAATGTAAGAAACCAAGGTCGAGGAGGAAGCCTCTTGCTGACATTACCAACCTCTATCTCTGGCGATACCAATTCAACACCACAGCACTCCAACCAAGTCCAAGAGTAACTATTACTCCCTCCTCTGCCTCAAATACTAGAAAAAGGAAAGCAATTCAGGAGCCCAATAGTAATACTACCACCATTCAAGTCACCAGTTCATCCAAATCCAAGTCCCTAAGGATGGGTTTCAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

123

Amino Acids

13.71

Weight (kDa)

10.66

Isoelectric Point (pI)

53.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 80
AfiI CCNNNNNNNGG 2 cut(s) 101, 358
AgsI TTSAA 2 cut(s) 211, 323
AjnI CCWGG 1 cut(s) 24
AoxI GGCC 1 cut(s) 6
AspS9I GGNCC 1 cut(s) 28
AsuHPI GGTGA 1 cut(s) 319
AvaII GGWCC 1 cut(s) 28
AxyI CCTNAGG 1 cut(s) 353
BanII GRGCYC 1 cut(s) 300
BccI CCATC 1 cut(s) 352
BciT130I CCWGG 1 cut(s) 26
BfaI CTAG 1 cut(s) 273
Bme1390I CCNGG 1 cut(s) 26
Bme18I GGWCC 1 cut(s) 28
BmgT120I GGNCC 1 cut(s) 28
BmiI GGNNCC 1 cut(s) 297
BmrFI CCNGG 1 cut(s) 26
BmrI ACTGGG 1 cut(s) 111
BmuI ACTGGG 1 cut(s) 111
BplI GAGNNNNNCTC 2 cut(s) 151, 183
BsaJI CCNNGG 1 cut(s) 149
BsaXI ACNNNNNCTCC 2 cut(s) 235, 265
Bsc4I CCNNNNNNNGG 2 cut(s) 101, 358
Bse1I ACTGG 2 cut(s) 106, 330
Bse21I CCTNAGG 1 cut(s) 353
Bse3DI GCAATG 1 cut(s) 9
BseBI CCWGG 1 cut(s) 26
BseDI CCNNGG 1 cut(s) 149
BseGI GGATG 3 cut(s) 48, 335, 363
BseLI CCNNNNNNNGG 2 cut(s) 101, 358
BseMI GCAATG 1 cut(s) 9
BseNI ACTGG 2 cut(s) 106, 330
BseRI GAGGAG 2 cut(s) 172, 247
BshFI GGCC 1 cut(s) 8
BslFI GGGAC 1 cut(s) 334
BslI CCNNNNNNNGG 2 cut(s) 101, 358
BsmFI GGGAC 1 cut(s) 334
BsnI GGCC 1 cut(s) 8
Bsp1286I GDGCHC 1 cut(s) 300
BspANI GGCC 1 cut(s) 8
BspLI GGNNCC 1 cut(s) 297
BsrDI GCAATG 1 cut(s) 9
BsrI ACTGG 2 cut(s) 106, 330
BssECI CCNNGG 1 cut(s) 149
BssT1I CCWWGG 1 cut(s) 149
Bst2UI CCWGG 1 cut(s) 26
BstC8I GCNNGC 1 cut(s) 16
BstDEI CTNAG 1 cut(s) 353
BstF5I GGATG 3 cut(s) 48, 335, 363
BstNI CCWGG 1 cut(s) 26
BstSCI CCNGG 1 cut(s) 24
Bsu36I CCTNAGG 1 cut(s) 353
BsuRI GGCC 1 cut(s) 8
BtsCI GGATG 3 cut(s) 48, 335, 363
Cac8I GCNNGC 1 cut(s) 16
Cfr13I GGNCC 1 cut(s) 28
CsiI ACCWGGT 1 cut(s) 24
CviJI RGCY 3 cut(s) 8, 166, 298
CviKI_1 RGCY 3 cut(s) 8, 166, 298
DdeI CTNAG 1 cut(s) 353
Eco130I CCWWGG 1 cut(s) 149
Eco24I GRGCYC 1 cut(s) 300
Eco47I GGWCC 1 cut(s) 28
Eco81I CCTNAGG 1 cut(s) 353
EcoRII CCWGG 1 cut(s) 24
EcoT14I CCWWGG 1 cut(s) 149
EcoT38I GRGCYC 1 cut(s) 300
ErhI CCWWGG 1 cut(s) 149
FaqI GGGAC 1 cut(s) 334
FblI GTMKAC 1 cut(s) 80
FokI GGATG 2 cut(s) 35, 322
FriOI GRGCYC 1 cut(s) 300
FspBI CTAG 1 cut(s) 273
HaeIII GGCC 1 cut(s) 8
HincII GTYRAC 1 cut(s) 81
HindII GTYRAC 1 cut(s) 81
HphI GGTGA 1 cut(s) 319
Hpy166II GTNNAC 2 cut(s) 31, 81
Hpy188I TCNGA 1 cut(s) 368
Hpy188III TCNNGA 1 cut(s) 293
Hpy8I GTNNAC 2 cut(s) 31, 81
Hpy99I CGWCG 3 cut(s) 85, 118, 121
HpyCH4V TGCA 1 cut(s) 68
HpyF3I CTNAG 1 cut(s) 353
LmnI GCTCC 1 cut(s) 295
LpnPI CCDG 7 cut(s) 11, 38, 87, 108, 181, 278, 343
MabI ACCWGGT 1 cut(s) 24
MaeI CTAG 1 cut(s) 273
MaeIII GTNAC 3 cut(s) 20, 241, 325
MboII GAAGA 1 cut(s) 145
MhlI GDGCHC 1 cut(s) 300
MluCI AATT 3 cut(s) 69, 206, 288
MmeI TCCRAC 1 cut(s) 250
MnlI CCTC 8 cut(s) 105, 150, 153, 177, 197, 265, 268, 274
MspR9I CCNGG 1 cut(s) 26
MvaI CCWGG 1 cut(s) 26
NlaIV GGNNCC 1 cut(s) 297
NmuCI GTSAC 2 cut(s) 20, 325
PcsI WCGNNNNNNNCGW 1 cut(s) 113
PflFI GACNNNGTC 1 cut(s) 26
Psp6I CCWGG 1 cut(s) 24
PspGI CCWGG 1 cut(s) 24
PspN4I GGNNCC 1 cut(s) 297
PspPI GGNCC 1 cut(s) 28
PsyI GACNNNGTC 1 cut(s) 26
SalI GTCGAC 1 cut(s) 79
Sau96I GGNCC 1 cut(s) 28
ScrFI CCNGG 1 cut(s) 26
SduI GDGCHC 1 cut(s) 300
SetI ASST 3 cut(s) 30, 155, 189
SexAI ACCWGGT 1 cut(s) 24
SinI GGWCC 1 cut(s) 28
Sse9I AATT 3 cut(s) 69, 206, 288
SspMI CTAG 1 cut(s) 273
StyD4I CCNGG 1 cut(s) 24
StyI CCWWGG 1 cut(s) 149
TaqI TCGA 2 cut(s) 80, 155
TasI AATT 3 cut(s) 69, 206, 288
TseFI GTSAC 2 cut(s) 20, 325
Tsp45I GTSAC 2 cut(s) 20, 325
TspDTI ATGAA 1 cut(s) 324
Tth111I GACNNNGTC 1 cut(s) 26
VpaK11BI GGWCC 1 cut(s) 28
XmiI GTMKAC 1 cut(s) 80
XspI CTAG 1 cut(s) 273
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.