FvH4_6g27260

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
OG0013215
Physical Location & Seq
Reverse (-)
20908606 .. 20909335
730 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g27260.t1

Sequence Viewer

Length: 336 bp
ATGGAGGCCATTGCCATCTGTGACCAAGTCCACAACAACAAAGAGAACATCCCTCCATTTCTGCCTGCAAATGCAAAGCCGAGCAAGAACCCACTTCCGGAAAATGGGTCAACTGCCAAGAAATGCAAGAAAATTATAAGGCTGAAGAGGAAGCCTCTCGCTGACATCACCAATCTCTACCAGTCAAGGTTGCCTCTGGCTCTTCCCAGCTCAACTCTTAGACCCTCTTCCTCTGTTACTGTCTCTGCTGTTTCAAATCCAAGGAAAAGAAAAGCAAATTCGAACGAGAGTGAGACCAGCTCAAACTCCAGGTCCCTAAGGATGGGTTTCAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

12.21

Weight (kDa)

10.62

Isoelectric Point (pI)

62.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 137
AccIII TCCGGA 1 cut(s) 97
AcsI RAATTY 1 cut(s) 277
AcuI CTGAAG 1 cut(s) 164
AfiI CCNNNNNNNGG 3 cut(s) 97, 104, 322
AgsI TTSAA 1 cut(s) 255
AjnI CCWGG 1 cut(s) 308
AluBI AGCT 2 cut(s) 210, 300
AluI AGCT 2 cut(s) 210, 300
Alw26I GTCTC 2 cut(s) 247, 287
Aor13HI TCCGGA 1 cut(s) 97
AoxI GGCC 1 cut(s) 6
ApoI RAATTY 1 cut(s) 277
ArsI GACNNNNNNTTYG 2 cut(s) 296, 328
AspS9I GGNCC 1 cut(s) 312
AsuHPI GGTGA 1 cut(s) 160
AsuII TTCGAA 1 cut(s) 281
AvaII GGWCC 1 cut(s) 312
AxyI CCTNAGG 1 cut(s) 317
BccI CCATC 2 cut(s) 23, 316
BciT130I CCWGG 1 cut(s) 310
BcoDI GTCTC 2 cut(s) 247, 287
Bme1390I CCNGG 1 cut(s) 310
Bme18I GGWCC 1 cut(s) 312
BmgT120I GGNCC 1 cut(s) 312
BmiI GGNNCC 1 cut(s) 314
BmrFI CCNGG 1 cut(s) 310
BplI GAGNNNNNCTC 4 cut(s) 139, 171, 284, 316
BpmI CTGGAG 1 cut(s) 292
Bpu14I TTCGAA 1 cut(s) 281
BsaI GGTCTC 1 cut(s) 287
BsaJI CCNNGG 1 cut(s) 260
BsaWI WCCGGW 1 cut(s) 97
Bsc4I CCNNNNNNNGG 3 cut(s) 97, 104, 322
Bse1I ACTGG 1 cut(s) 181
Bse21I CCTNAGG 1 cut(s) 317
Bse3DI GCAATG 1 cut(s) 9
BseAI TCCGGA 1 cut(s) 97
BseBI CCWGG 1 cut(s) 310
BseDI CCNNGG 1 cut(s) 260
BseGI GGATG 2 cut(s) 48, 327
BseLI CCNNNNNNNGG 3 cut(s) 97, 104, 322
BseMI GCAATG 1 cut(s) 9
BseNI ACTGG 1 cut(s) 181
BseYI CCCAGC 1 cut(s) 206
BshFI GGCC 1 cut(s) 8
BsiSI CCGG 1 cut(s) 98
BslFI GGGAC 1 cut(s) 298
BslI CCNNNNNNNGG 3 cut(s) 97, 104, 322
BsmAI GTCTC 2 cut(s) 247, 287
BsmFI GGGAC 1 cut(s) 298
BsnI GGCC 1 cut(s) 8
Bso31I GGTCTC 1 cut(s) 287
Bsp119I TTCGAA 1 cut(s) 281
Bsp13I TCCGGA 1 cut(s) 97
BspANI GGCC 1 cut(s) 8
BspEI TCCGGA 1 cut(s) 97
BspLI GGNNCC 1 cut(s) 314
BspQI GCTCTTC 1 cut(s) 207
BspT104I TTCGAA 1 cut(s) 281
BspTNI GGTCTC 1 cut(s) 287
BsrDI GCAATG 1 cut(s) 9
BsrI ACTGG 1 cut(s) 181
BssECI CCNNGG 1 cut(s) 260
BssT1I CCWWGG 1 cut(s) 260
Bst2UI CCWGG 1 cut(s) 310
Bst4CI ACNGT 1 cut(s) 241
Bst6I CTCTTC 3 cut(s) 140, 207, 232
BstBI TTCGAA 1 cut(s) 281
BstC8I GCNNGC 1 cut(s) 66
BstDEI CTNAG 2 cut(s) 218, 317
BstF5I GGATG 2 cut(s) 48, 327
BstMAI GTCTC 2 cut(s) 247, 287
BstNI CCWGG 1 cut(s) 310
BstSCI CCNGG 1 cut(s) 308
Bsu36I CCTNAGG 1 cut(s) 317
BsuRI GGCC 1 cut(s) 8
BtsCI GGATG 2 cut(s) 48, 327
Cac8I GCNNGC 1 cut(s) 66
Cfr13I GGNCC 1 cut(s) 312
CviJI RGCY 7 cut(s) 8, 79, 142, 154, 200, 210, 300
CviKI_1 RGCY 7 cut(s) 8, 79, 142, 154, 200, 210, 300
DdeI CTNAG 2 cut(s) 218, 317
Eam1104I CTCTTC 3 cut(s) 140, 207, 232
EarI CTCTTC 3 cut(s) 140, 207, 232
Eco130I CCWWGG 1 cut(s) 260
Eco31I GGTCTC 1 cut(s) 287
Eco47I GGWCC 1 cut(s) 312
Eco57I CTGAAG 1 cut(s) 164
Eco81I CCTNAGG 1 cut(s) 317
EcoO109I RGGNCCY 1 cut(s) 312
EcoRII CCWGG 1 cut(s) 308
EcoT14I CCWWGG 1 cut(s) 260
ErhI CCWWGG 1 cut(s) 260
FaiI YATR 1 cut(s) 137
FaqI GGGAC 1 cut(s) 298
FokI GGATG 1 cut(s) 35
GsaI CCCAGC 1 cut(s) 210
GsuI CTGGAG 1 cut(s) 292
HaeIII GGCC 1 cut(s) 8
HapII CCGG 1 cut(s) 98
HincII GTYRAC 1 cut(s) 111
HindII GTYRAC 1 cut(s) 111
HpaII CCGG 1 cut(s) 98
HphI GGTGA 1 cut(s) 160
Hpy166II GTNNAC 2 cut(s) 31, 111
Hpy188I TCNGA 1 cut(s) 332
Hpy188III TCNNGA 1 cut(s) 98
Hpy8I GTNNAC 2 cut(s) 31, 111
HpyCH4III ACNGT 1 cut(s) 241
HpyCH4V TGCA 3 cut(s) 68, 74, 126
HpyF3I CTNAG 2 cut(s) 218, 317
Kpn2I TCCGGA 1 cut(s) 97
LguI GCTCTTC 1 cut(s) 207
LpnPI CCDG 8 cut(s) 78, 111, 182, 194, 220, 295, 310, 322
MaeIII GTNAC 2 cut(s) 20, 235
MboII GAAGA 3 cut(s) 157, 194, 219
MluCI AATT 2 cut(s) 132, 277
MnlI CCTC 6 cut(s) 63, 141, 165, 204, 235, 241
MroI TCCGGA 1 cut(s) 97
MspI CCGG 1 cut(s) 98
MspR9I CCNGG 1 cut(s) 310
MvaI CCWGG 1 cut(s) 310
NlaIV GGNNCC 1 cut(s) 314
NmeAIII GCCGAG 1 cut(s) 105
NmuCI GTSAC 1 cut(s) 20
NspV TTCGAA 1 cut(s) 281
PciSI GCTCTTC 1 cut(s) 207
PflFI GACNNNGTC 1 cut(s) 26
PpuMI RGGWCCY 1 cut(s) 312
PsiI TTATAA 1 cut(s) 137
Psp5II RGGWCCY 1 cut(s) 312
Psp6I CCWGG 1 cut(s) 308
PspFI CCCAGC 1 cut(s) 206
PspGI CCWGG 1 cut(s) 308
PspN4I GGNNCC 1 cut(s) 314
PspPI GGNCC 1 cut(s) 312
PspPPI RGGWCCY 1 cut(s) 312
PsyI GACNNNGTC 1 cut(s) 26
SapI GCTCTTC 1 cut(s) 207
Sau96I GGNCC 1 cut(s) 312
ScrFI CCNGG 1 cut(s) 310
SetI ASST 4 cut(s) 191, 212, 302, 314
SfuI TTCGAA 1 cut(s) 281
SinI GGWCC 1 cut(s) 312
Sse9I AATT 2 cut(s) 132, 277
StyD4I CCNGG 1 cut(s) 308
StyI CCWWGG 1 cut(s) 260
TaaI ACNGT 1 cut(s) 241
TaqI TCGA 1 cut(s) 281
TasI AATT 2 cut(s) 132, 277
TseFI GTSAC 1 cut(s) 20
Tsp45I GTSAC 1 cut(s) 20
Tth111I GACNNNGTC 1 cut(s) 26
VpaK11BI GGWCC 1 cut(s) 312
XapI RAATTY 1 cut(s) 277
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.