Rh2BG345900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
46508074 .. 46508433
360 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG345900.1

Sequence Viewer

Length: 360 bp
ATGGAGGCCAATGCTTGCTGTGACCAGGTCCACAGCAACAAAGAGAACATCCCCCCATTGTTTTCTGCCGATGCAAAGTCGACCAGCCCATTTCCTCAAACTGGGTCGTTGTCATCGTCTGGGTCTTGGAAGAAGAACTGTAAGAAACTAAGGTCGAGGAGGAAGCCTCTTGCTGACATTACCAACCTCTACCTCTGGCAATACCAATTAAACACCAATGCACTCCAACCAAATCCAAGAGTAACTACTCCCTCCTCTGCCTCAAATCCTAGAAAAAGGAAATCAATTCAGGAGGCTAACAGTACCACCATCCAAGTCACCAACTCCAAATCCAAGTCTCTCAGGATGGGTTTCAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

119

Amino Acids

13.27

Weight (kDa)

10.35

Isoelectric Point (pI)

48.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 80
AfaI GTAC 1 cut(s) 304
AfiI CCNNNNNNNGG 1 cut(s) 101
AjnI CCWGG 1 cut(s) 24
Alw26I GTCTC 1 cut(s) 342
AoxI GGCC 1 cut(s) 6
AspS9I GGNCC 1 cut(s) 28
AsuHPI GGTGA 1 cut(s) 310
AvaII GGWCC 1 cut(s) 28
BccI CCATC 2 cut(s) 317, 340
BciT130I CCWGG 1 cut(s) 26
BcoDI GTCTC 1 cut(s) 342
BfaI CTAG 1 cut(s) 270
Bme1390I CCNGG 1 cut(s) 26
Bme18I GGWCC 1 cut(s) 28
BmgT120I GGNCC 1 cut(s) 28
BmrFI CCNGG 1 cut(s) 26
BmrI ACTGGG 1 cut(s) 111
BmsI GCATC 1 cut(s) 61
BmuI ACTGGG 1 cut(s) 111
BplI GAGNNNNNCTC 2 cut(s) 151, 183
Bsc4I CCNNNNNNNGG 1 cut(s) 101
Bse1I ACTGG 1 cut(s) 106
BseBI CCWGG 1 cut(s) 26
BseGI GGATG 3 cut(s) 48, 309, 351
BseLI CCNNNNNNNGG 1 cut(s) 101
BseMII CTCAG 1 cut(s) 355
BseNI ACTGG 1 cut(s) 106
BseRI GAGGAG 2 cut(s) 172, 244
BshFI GGCC 1 cut(s) 8
BslI CCNNNNNNNGG 1 cut(s) 101
BsmAI GTCTC 1 cut(s) 342
BsnI GGCC 1 cut(s) 8
BspANI GGCC 1 cut(s) 8
BspCNI CTCAG 1 cut(s) 354
BsrI ACTGG 1 cut(s) 106
Bst2UI CCWGG 1 cut(s) 26
Bst4CI ACNGT 2 cut(s) 140, 302
BstC8I GCNNGC 1 cut(s) 16
BstDEI CTNAG 2 cut(s) 149, 341
BstF5I GGATG 3 cut(s) 48, 309, 351
BstMAI GTCTC 1 cut(s) 342
BstNI CCWGG 1 cut(s) 26
BstSCI CCNGG 1 cut(s) 24
BsuRI GGCC 1 cut(s) 8
BtsCI GGATG 3 cut(s) 48, 309, 351
Cac8I GCNNGC 1 cut(s) 16
Cfr13I GGNCC 1 cut(s) 28
CsiI ACCWGGT 1 cut(s) 24
Csp6I GTAC 1 cut(s) 303
CviJI RGCY 4 cut(s) 8, 87, 166, 296
CviKI_1 RGCY 4 cut(s) 8, 87, 166, 296
CviQI GTAC 1 cut(s) 303
DdeI CTNAG 2 cut(s) 149, 341
Eco47I GGWCC 1 cut(s) 28
EcoRII CCWGG 1 cut(s) 24
FblI GTMKAC 1 cut(s) 80
FokI GGATG 2 cut(s) 35, 296
FspBI CTAG 1 cut(s) 270
HaeIII GGCC 1 cut(s) 8
HincII GTYRAC 1 cut(s) 81
HindII GTYRAC 1 cut(s) 81
HphI GGTGA 1 cut(s) 310
Hpy166II GTNNAC 2 cut(s) 31, 81
Hpy188I TCNGA 1 cut(s) 356
Hpy188III TCNNGA 2 cut(s) 290, 343
Hpy8I GTNNAC 2 cut(s) 31, 81
HpyCH4III ACNGT 2 cut(s) 140, 302
HpyCH4V TGCA 2 cut(s) 74, 221
HpyF3I CTNAG 2 cut(s) 149, 341
LpnPI CCDG 8 cut(s) 11, 38, 87, 97, 105, 181, 275, 328
LweI GCATC 1 cut(s) 61
MabI ACCWGGT 1 cut(s) 24
MaeI CTAG 1 cut(s) 270
MaeIII GTNAC 3 cut(s) 20, 241, 316
MboII GAAGA 2 cut(s) 142, 145
MluCI AATT 2 cut(s) 206, 285
MmeI TCCRAC 1 cut(s) 250
MseI TTAA 1 cut(s) 209
MspR9I CCNGG 1 cut(s) 26
MvaI CCWGG 1 cut(s) 26
NmuCI GTSAC 2 cut(s) 20, 316
PcsI WCGNNNNNNNCGW 1 cut(s) 113
PflFI GACNNNGTC 1 cut(s) 26
Psp6I CCWGG 1 cut(s) 24
PspGI CCWGG 1 cut(s) 24
PspPI GGNCC 1 cut(s) 28
PsyI GACNNNGTC 1 cut(s) 26
RsaI GTAC 1 cut(s) 304
RsaNI GTAC 1 cut(s) 303
SalI GTCGAC 1 cut(s) 79
SaqAI TTAA 1 cut(s) 209
Sau96I GGNCC 1 cut(s) 28
ScrFI CCNGG 1 cut(s) 26
SetI ASST 4 cut(s) 30, 155, 189, 195
SexAI ACCWGGT 1 cut(s) 24
SfaNI GCATC 1 cut(s) 61
SinI GGWCC 1 cut(s) 28
Sse9I AATT 2 cut(s) 206, 285
SspMI CTAG 1 cut(s) 270
StyD4I CCNGG 1 cut(s) 24
TaaI ACNGT 2 cut(s) 140, 302
TaqI TCGA 2 cut(s) 80, 155
TasI AATT 2 cut(s) 206, 285
Tru1I TTAA 1 cut(s) 209
Tru9I TTAA 1 cut(s) 209
TseFI GTSAC 2 cut(s) 20, 316
Tsp45I GTSAC 2 cut(s) 20, 316
Tth111I GACNNNGTC 1 cut(s) 26
VpaK11BI GGWCC 1 cut(s) 28
XmiI GTMKAC 1 cut(s) 80
XspI CTAG 1 cut(s) 270
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.