MD02G1183800.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
Physical Location & Seq
Forward (+)
16678687 .. 16681450
2764 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1183800.v1.1.491

Sequence Viewer

Length: 282 bp
ATGGACCCTAGATACACTGGAGAGATTTTGAAGCATTTGGAGAAGCAAAACGAGCTCCTCACGGAAGCAAAAATATCAATGTCTGAGGAATTGCACCAACTGAAGGTCGAAGAAGAAATGCTGATGCGTAAGTTTTATGAGATAATGTCAGCTCATGGTAAACTTAAAAAGAATGAAGGTTGTGGTACAGTTTCAGATGACGGTGAAATTGGACGAGGACCGTTGATGACTTCAAATTCTGTTTTCACATTGTCGAATGAATGTGTATGTAGTATTGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

10.54

Weight (kDa)

5.06

Isoelectric Point (pI)

39.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 235
AcuI CTGAAG 1 cut(s) 122
AfaI GTAC 1 cut(s) 187
AfiI CCNNNNNNNGG 1 cut(s) 103
AgsI TTSAA 3 cut(s) 31, 234, 278
AluBI AGCT 2 cut(s) 55, 152
AluI AGCT 2 cut(s) 55, 152
Alw21I GWGCWC 1 cut(s) 57
ApoI RAATTY 1 cut(s) 235
AspS9I GGNCC 2 cut(s) 4, 218
AsuHPI GGTGA 1 cut(s) 215
AvaII GGWCC 2 cut(s) 4, 218
BanII GRGCYC 1 cut(s) 57
Bbv12I GWGCWC 1 cut(s) 57
BfaI CTAG 1 cut(s) 9
Bme18I GGWCC 2 cut(s) 4, 218
BmgT120I GGNCC 2 cut(s) 4, 218
BmiI GGNNCC 1 cut(s) 6
BmsI GCATC 1 cut(s) 114
BpmI CTGGAG 1 cut(s) 39
Bsc4I CCNNNNNNNGG 1 cut(s) 103
Bse1I ACTGG 1 cut(s) 22
BseLI CCNNNNNNNGG 1 cut(s) 103
BseMII CTCAG 1 cut(s) 75
BseNI ACTGG 1 cut(s) 22
BseRI GAGGAG 1 cut(s) 47
BsiHKAI GWGCWC 1 cut(s) 57
BslI CCNNNNNNNGG 1 cut(s) 103
Bsp1286I GDGCHC 1 cut(s) 57
BspCNI CTCAG 1 cut(s) 76
BspLI GGNNCC 1 cut(s) 6
BsrI ACTGG 1 cut(s) 22
Bst4CI ACNGT 3 cut(s) 190, 203, 222
BstDEI CTNAG 1 cut(s) 84
BstMWI GCNNNNNNNGC 1 cut(s) 52
BtsIMutI CAGTG 1 cut(s) 15
Cfr13I GGNCC 2 cut(s) 4, 218
Csp6I GTAC 1 cut(s) 186
CviAII CATG 1 cut(s) 155
CviJI RGCY 2 cut(s) 55, 152
CviKI_1 RGCY 2 cut(s) 55, 152
CviQI GTAC 1 cut(s) 186
DdeI CTNAG 1 cut(s) 84
Ecl136II GAGCTC 1 cut(s) 55
Eco24I GRGCYC 1 cut(s) 57
Eco47I GGWCC 2 cut(s) 4, 218
Eco53kI GAGCTC 1 cut(s) 55
Eco57I CTGAAG 1 cut(s) 122
EcoICRI GAGCTC 1 cut(s) 55
EcoT38I GRGCYC 1 cut(s) 57
FaeI CATG 1 cut(s) 158
FaiI YATR 3 cut(s) 138, 156, 268
FatI CATG 1 cut(s) 154
FriOI GRGCYC 1 cut(s) 57
FspBI CTAG 1 cut(s) 9
GsuI CTGGAG 1 cut(s) 39
Hin1II CATG 1 cut(s) 158
HphI GGTGA 1 cut(s) 215
Hpy166II GTNNAC 1 cut(s) 161
Hpy188I TCNGA 2 cut(s) 85, 196
Hpy8I GTNNAC 1 cut(s) 161
HpyAV CCTTC 2 cut(s) 97, 170
HpyCH4III ACNGT 3 cut(s) 190, 203, 222
HpyCH4V TGCA 1 cut(s) 94
HpyF10VI GCNNNNNNNGC 1 cut(s) 52
HpyF3I CTNAG 1 cut(s) 84
Hsp92II CATG 1 cut(s) 158
LmnI GCTCC 1 cut(s) 60
LpnPI CCDG 1 cut(s) 3
LweI GCATC 1 cut(s) 114
MaeI CTAG 1 cut(s) 9
MboII GAAGA 2 cut(s) 122, 125
MhlI GDGCHC 1 cut(s) 57
MluCI AATT 3 cut(s) 89, 207, 235
MnlI CCTC 3 cut(s) 68, 79, 209
MseI TTAA 1 cut(s) 165
MwoI GCNNNNNNNGC 1 cut(s) 52
NlaIII CATG 1 cut(s) 158
NlaIV GGNNCC 1 cut(s) 6
Psp124BI GAGCTC 1 cut(s) 57
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 2 cut(s) 4, 218
RsaI GTAC 1 cut(s) 187
RsaNI GTAC 1 cut(s) 186
SacI GAGCTC 1 cut(s) 57
SaqAI TTAA 1 cut(s) 165
Sau96I GGNCC 2 cut(s) 4, 218
SduI GDGCHC 1 cut(s) 57
SetI ASST 4 cut(s) 57, 108, 154, 181
SfaNI GCATC 1 cut(s) 114
SgeI CNNG 6 cut(s) 21, 30, 64, 73, 167, 227
SinI GGWCC 2 cut(s) 4, 218
Sse9I AATT 3 cut(s) 89, 207, 235
SspMI CTAG 1 cut(s) 9
SstI GAGCTC 1 cut(s) 57
TaaI ACNGT 3 cut(s) 190, 203, 222
TaqI TCGA 2 cut(s) 108, 254
TasI AATT 3 cut(s) 89, 207, 235
Tru1I TTAA 1 cut(s) 165
Tru9I TTAA 1 cut(s) 165
TscAI CASTG 1 cut(s) 22
TspDTI ATGAA 2 cut(s) 189, 273
TspGWI ACGGA 1 cut(s) 77
TspRI CASTG 1 cut(s) 22
VpaK11BI GGWCC 2 cut(s) 4, 218
XapI RAATTY 1 cut(s) 235
XspI CTAG 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.