Prupe.6G222400_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Reverse (-)
22741053 .. 22743282
2230 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G222400.6

Sequence Viewer

Length: 261 bp
ATGGACCCTAGATACACAGGAGAGATATTGAAGCATTTGGAGAAGCAAAGTGAGCTACTTAAGGAAGCCAAAATATCAATGTCTGAAGAATTGCATCAGTTGAAGGTAGAAGAAGAAATGCTGATGCGCAAGTTCTATGAGATCATGTCAGCTCATGGTAAAGTTAAAAAGAATGAAGATCCCAGTAAAGTTTCAGATGATGGAGAAATTGGAAACTCCACTGCGATAGTCACTACTAGTAGCAATGAAGAATGCAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

9.86

Weight (kDa)

5.19

Isoelectric Point (pI)

51.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 128
AclWI GGATC 1 cut(s) 173
AcuI CTGAAG 1 cut(s) 105
AflII CTTAAG 1 cut(s) 59
AgsI TTSAA 2 cut(s) 31, 103
AhlI ACTAGT 1 cut(s) 236
AluBI AGCT 2 cut(s) 55, 152
AluI AGCT 2 cut(s) 55, 152
AlwI GGATC 1 cut(s) 173
AspLEI GCGC 1 cut(s) 129
AspS9I GGNCC 1 cut(s) 4
AvaII GGWCC 1 cut(s) 4
BccI CCATC 1 cut(s) 194
BcuI ACTAGT 1 cut(s) 236
BfaI CTAG 2 cut(s) 9, 237
BfrI CTTAAG 1 cut(s) 59
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 1 cut(s) 6
BmrI ACTGGG 1 cut(s) 177
BmsI GCATC 2 cut(s) 103, 114
BmuI ACTGGG 1 cut(s) 177
Bse1I ACTGG 1 cut(s) 183
Bse3DI GCAATG 1 cut(s) 250
BseMI GCAATG 1 cut(s) 250
BseNI ACTGG 1 cut(s) 183
BsmI GAATGC 1 cut(s) 257
Bsp143I GATC 2 cut(s) 141, 178
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 1 cut(s) 173
BspTI CTTAAG 1 cut(s) 59
BsrDI GCAATG 1 cut(s) 250
BsrI ACTGG 1 cut(s) 183
BssMI GATC 2 cut(s) 141, 178
BstAFI CTTAAG 1 cut(s) 59
BstHHI GCGC 1 cut(s) 129
BstKTI GATC 2 cut(s) 144, 181
BstMBI GATC 2 cut(s) 141, 178
BstMWI GCNNNNNNNGC 1 cut(s) 52
BstX2I RGATCY 1 cut(s) 178
BstYI RGATCY 1 cut(s) 178
BtsI GCAGTG 1 cut(s) 219
BtsIMutI CAGTG 1 cut(s) 219
CfoI GCGC 1 cut(s) 129
Cfr13I GGNCC 1 cut(s) 4
CviAII CATG 2 cut(s) 145, 155
CviJI RGCY 3 cut(s) 55, 68, 152
CviKI_1 RGCY 3 cut(s) 55, 68, 152
DpnI GATC 2 cut(s) 143, 180
DpnII GATC 2 cut(s) 141, 178
Eco47I GGWCC 1 cut(s) 4
Eco57I CTGAAG 1 cut(s) 105
FaeI CATG 2 cut(s) 148, 158
FaiI YATR 3 cut(s) 138, 146, 156
FatI CATG 2 cut(s) 144, 154
FspBI CTAG 2 cut(s) 9, 237
FspI TGCGCA 1 cut(s) 128
GlaI GCGC 1 cut(s) 128
HhaI GCGC 1 cut(s) 129
Hin1II CATG 2 cut(s) 148, 158
Hin6I GCGC 1 cut(s) 127
HinP1I GCGC 1 cut(s) 127
Hpy188I TCNGA 2 cut(s) 85, 196
HpyAV CCTTC 1 cut(s) 97
HpyCH4V TGCA 2 cut(s) 94, 255
HpyF10VI GCNNNNNNNGC 1 cut(s) 52
Hsp92II CATG 2 cut(s) 148, 158
HspAI GCGC 1 cut(s) 127
Kzo9I GATC 2 cut(s) 141, 178
LpnPI CCDG 2 cut(s) 3, 196
LweI GCATC 2 cut(s) 103, 114
MaeI CTAG 2 cut(s) 9, 237
MaeIII GTNAC 1 cut(s) 229
MalI GATC 2 cut(s) 143, 180
MboI GATC 2 cut(s) 141, 178
MboII GAAGA 5 cut(s) 98, 122, 125, 188, 260
MflI RGATCY 1 cut(s) 178
MluCI AATT 2 cut(s) 89, 207
MseI TTAA 2 cut(s) 60, 165
MspCI CTTAAG 1 cut(s) 59
Mva1269I GAATGC 1 cut(s) 257
MwoI GCNNNNNNNGC 1 cut(s) 52
NdeII GATC 2 cut(s) 141, 178
NlaIII CATG 2 cut(s) 148, 158
NlaIV GGNNCC 1 cut(s) 6
NmuCI GTSAC 1 cut(s) 229
NsbI TGCGCA 1 cut(s) 128
PctI GAATGC 1 cut(s) 257
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 4
PsuI RGATCY 1 cut(s) 178
SaqAI TTAA 2 cut(s) 60, 165
Sau3AI GATC 2 cut(s) 141, 178
Sau96I GGNCC 1 cut(s) 4
SetI ASST 3 cut(s) 57, 108, 154
SfaNI GCATC 2 cut(s) 103, 114
SgeI CNNG 7 cut(s) 21, 30, 142, 157, 167, 195, 249
SinI GGWCC 1 cut(s) 4
SmlI CTYRAG 1 cut(s) 59
SmoI CTYRAG 1 cut(s) 59
SpeI ACTAGT 1 cut(s) 236
Sse9I AATT 2 cut(s) 89, 207
SspMI CTAG 2 cut(s) 9, 237
TasI AATT 2 cut(s) 89, 207
Tru1I TTAA 2 cut(s) 60, 165
Tru9I TTAA 2 cut(s) 60, 165
TscAI CASTG 1 cut(s) 226
TseFI GTSAC 1 cut(s) 229
Tsp45I GTSAC 1 cut(s) 229
TspDTI ATGAA 2 cut(s) 189, 261
TspRI CASTG 1 cut(s) 226
Vha464I CTTAAG 1 cut(s) 59
VpaK11BI GGWCC 1 cut(s) 4
XspI CTAG 2 cut(s) 9, 237
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.