MD05G1114000.v1.1

cell redox homeostasis

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0013119
Physical Location & Seq
Reverse (-)
23290355 .. 23290729
375 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1114000.v1.1.491

Sequence Viewer

Length: 375 bp
ATGGCTTTAGCTTCAAAACCCACAGCTACTCTCCCGCGACCTTACCATTTCATCTCCCACCGCCTTCCCTCCATCTTTTTGTCACCTCCAAGAAAACCCACCACCAAAAACTCACTCTTTTCTCCCTCAACAGTGAAAAGAAGGTTGCTTTGCAGCCCCTCTCATGGTAAACATGTCAGAGAAGATTATCTTGTGAAGAAGGCGTCGGCTGAGGAGGTCCAGGAACTGGTAAAAGGAGACAGAAATGTACCCATTATTGTTGATTTCTTTGCAACACGGTGCGGACCCTGTATATTGATGGCTCAAGAACTTGAAATGGCTCCTGGAGCCAGTGGAGATGTCAACTTGCAGAAGAGGAGCACATGGGGTCAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TPR_1 TPR_11 TPR_16 TPR_8 Thioredoxin

Protein Analysis

125

Amino Acids

13.78

Weight (kDa)

9.81

Isoelectric Point (pI)

51.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013119)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G06730
fragaria_vesca FvH4_7g03410
malus_domestica MD02G1283300.v1.1 MD05G1114000.v1.1 MD07G1048800.v1.1
prunus_persica Prupe.2G039200_v2.0.a1
pyrus_communis pycom02g24140 pycom07g03540
rosa_chinensis RchiOBHm_Chr1g0325731
rosa_laevigata RLG00000030110
rosa_multiflora Rmu_sc0000703.1_g000005
rosa_roxburghii Rroxscaffold_4G00324440
rosa_rugosa Rorug01G0054000 Rorug01G0054100
rosa_samantha Rh1BG057000 Rh1CG070200 Rh1DG074800
rosa_wichuraiana Rw1G005760

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 226
AccII CGCG 1 cut(s) 37
AciI CCGC 3 cut(s) 35, 61, 282
AcyI GRCGYC 1 cut(s) 203
AfaI GTAC 1 cut(s) 249
AfiI CCNNNNNNNGG 2 cut(s) 164, 226
AflIII ACRYGT 1 cut(s) 172
AgsI TTSAA 2 cut(s) 15, 314
AjnI CCWGG 2 cut(s) 219, 322
AluBI AGCT 2 cut(s) 11, 26
AluI AGCT 2 cut(s) 11, 26
Alw21I GWGCWC 1 cut(s) 362
Alw26I GTCTC 1 cut(s) 231
AlwNI CAGNNNCTG 1 cut(s) 226
ApeKI GCWGC 1 cut(s) 153
AspS9I GGNCC 2 cut(s) 217, 284
AsuHPI GGTGA 1 cut(s) 75
AvaII GGWCC 2 cut(s) 217, 284
Bbv12I GWGCWC 1 cut(s) 362
BbvCI CCTCAGC 1 cut(s) 210
BbvI GCAGC 1 cut(s) 165
BccI CCATC 2 cut(s) 80, 292
BciT130I CCWGG 2 cut(s) 221, 324
BcoDI GTCTC 1 cut(s) 231
BisI GCNGC 1 cut(s) 154
BlsI GCNGC 1 cut(s) 155
Bme1390I CCNGG 2 cut(s) 221, 324
Bme18I GGWCC 2 cut(s) 217, 284
BmgT120I GGNCC 2 cut(s) 217, 284
BmiI GGNNCC 3 cut(s) 286, 321, 328
BmrFI CCNGG 2 cut(s) 221, 324
BpmI CTGGAG 1 cut(s) 345
Bpu10I CCTNAGC 1 cut(s) 210
BpuEI CTTGAG 1 cut(s) 288
BsaHI GRCGYC 1 cut(s) 203
Bsc4I CCNNNNNNNGG 2 cut(s) 164, 226
Bse1I ACTGG 2 cut(s) 231, 330
BseBI CCWGG 2 cut(s) 221, 324
BseLI CCNNNNNNNGG 2 cut(s) 164, 226
BseMII CTCAG 1 cut(s) 201
BseNI ACTGG 2 cut(s) 231, 330
BseRI GAGGAG 2 cut(s) 227, 370
BseXI GCAGC 1 cut(s) 165
Bsh1236I CGCG 1 cut(s) 37
BsiHKAI GWGCWC 1 cut(s) 362
BslI CCNNNNNNNGG 2 cut(s) 164, 226
BsmAI GTCTC 1 cut(s) 231
Bsp1286I GDGCHC 1 cut(s) 362
BspACI CCGC 3 cut(s) 35, 61, 282
BspCNI CTCAG 1 cut(s) 202
BspFNI CGCG 1 cut(s) 37
BspLI GGNNCC 3 cut(s) 286, 321, 328
BsrI ACTGG 2 cut(s) 231, 330
BssNI GRCGYC 1 cut(s) 203
Bst2UI CCWGG 2 cut(s) 221, 324
Bst4CI ACNGT 2 cut(s) 133, 279
Bst6I CTCTTC 1 cut(s) 347
BstACI GRCGYC 1 cut(s) 203
BstDEI CTNAG 1 cut(s) 210
BstFNI CGCG 1 cut(s) 37
BstMAI GTCTC 1 cut(s) 231
BstMWI GCNNNNNNNGC 1 cut(s) 326
BstNI CCWGG 2 cut(s) 221, 324
BstNSI RCATGY 1 cut(s) 176
BstSCI CCNGG 2 cut(s) 219, 322
BstUI CGCG 1 cut(s) 37
BstV1I GCAGC 1 cut(s) 165
BtsIMutI CAGTG 2 cut(s) 138, 337
CaiI CAGNNNCTG 1 cut(s) 226
Cfr13I GGNCC 2 cut(s) 217, 284
CseI GACGC 1 cut(s) 192
Csp6I GTAC 1 cut(s) 248
CviAII CATG 3 cut(s) 164, 173, 363
CviJI RGCY 8 cut(s) 5, 11, 26, 156, 209, 302, 320, 329
CviKI_1 RGCY 8 cut(s) 5, 11, 26, 156, 209, 302, 320, 329
CviQI GTAC 1 cut(s) 248
DdeI CTNAG 1 cut(s) 210
Eam1104I CTCTTC 1 cut(s) 347
EarI CTCTTC 1 cut(s) 347
Eco47I GGWCC 2 cut(s) 217, 284
EcoRII CCWGG 2 cut(s) 219, 322
FaeI CATG 3 cut(s) 167, 176, 366
FaiI YATR 4 cut(s) 165, 174, 293, 364
FalI AAGNNNNNCTT 2 cut(s) 174, 206
FatI CATG 3 cut(s) 163, 172, 362
FauI CCCGC 1 cut(s) 42
Fnu4HI GCNGC 1 cut(s) 154
Fsp4HI GCNGC 1 cut(s) 154
GluI GCNGC 1 cut(s) 154
GsuI CTGGAG 1 cut(s) 345
HgaI GACGC 1 cut(s) 192
Hin1I GRCGYC 1 cut(s) 203
Hin1II CATG 3 cut(s) 167, 176, 366
HincII GTYRAC 1 cut(s) 343
HindII GTYRAC 1 cut(s) 343
HphI GGTGA 1 cut(s) 75
Hpy166II GTNNAC 2 cut(s) 170, 343
Hpy188I TCNGA 1 cut(s) 179
Hpy188III TCNNGA 1 cut(s) 305
Hpy8I GTNNAC 2 cut(s) 170, 343
Hpy99I CGWCG 1 cut(s) 208
HpyAV CCTTC 3 cut(s) 74, 135, 193
HpyCH4III ACNGT 2 cut(s) 133, 279
HpyCH4V TGCA 3 cut(s) 153, 272, 349
HpyF10VI GCNNNNNNNGC 1 cut(s) 326
HpyF3I CTNAG 1 cut(s) 210
Hsp92I GRCGYC 1 cut(s) 203
Hsp92II CATG 3 cut(s) 167, 176, 366
LmnI GCTCC 3 cut(s) 325, 326, 357
LpnPI CCDG 7 cut(s) 206, 212, 233, 301, 309, 336, 343
Lsp1109I GCAGC 1 cut(s) 165
MaeIII GTNAC 1 cut(s) 81
MboII GAAGA 3 cut(s) 194, 208, 364
MhlI GDGCHC 1 cut(s) 362
MnlI CCTC 7 cut(s) 79, 96, 136, 169, 205, 208, 348
MspR9I CCNGG 2 cut(s) 221, 324
MvaI CCWGG 2 cut(s) 221, 324
MvnI CGCG 1 cut(s) 37
MwoI GCNNNNNNNGC 1 cut(s) 326
NlaIII CATG 3 cut(s) 167, 176, 366
NlaIV GGNNCC 3 cut(s) 286, 321, 328
NmuCI GTSAC 1 cut(s) 81
NspI RCATGY 1 cut(s) 176
PciI ACATGT 1 cut(s) 172
PflMI CCANNNNNTGG 1 cut(s) 226
PfoI TCCNGGA 2 cut(s) 219, 322
PkrI GCNGC 1 cut(s) 155
PscI ACATGT 1 cut(s) 172
Psp6I CCWGG 2 cut(s) 219, 322
PspGI CCWGG 2 cut(s) 219, 322
PspN4I GGNNCC 3 cut(s) 286, 321, 328
PspPI GGNCC 2 cut(s) 217, 284
PstNI CAGNNNCTG 1 cut(s) 226
RsaI GTAC 1 cut(s) 249
RsaNI GTAC 1 cut(s) 248
SatI GCNGC 1 cut(s) 154
Sau96I GGNCC 2 cut(s) 217, 284
ScrFI CCNGG 2 cut(s) 221, 324
SduI GDGCHC 1 cut(s) 362
SetI ASST 6 cut(s) 13, 28, 43, 88, 146, 219
SinI GGWCC 2 cut(s) 217, 284
SmlI CTYRAG 1 cut(s) 303
SmoI CTYRAG 1 cut(s) 303
SsiI CCGC 3 cut(s) 35, 61, 282
StyD4I CCNGG 2 cut(s) 219, 322
TaaI ACNGT 2 cut(s) 133, 279
TscAI CASTG 2 cut(s) 138, 337
TseFI GTSAC 1 cut(s) 81
TseI GCWGC 1 cut(s) 153
Tsp45I GTSAC 1 cut(s) 81
TspDTI ATGAA 1 cut(s) 40
TspRI CASTG 2 cut(s) 138, 337
Van91I CCANNNNNTGG 1 cut(s) 226
VpaK11BI GGWCC 2 cut(s) 217, 284
XceI RCATGY 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.