MD06G1106500.v1.1

Nonspecific lipid-transfer protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
OG0015621
Physical Location & Seq
Reverse (-)
24548836 .. 24549320
485 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1106500.v1.1.491

Sequence Viewer

Length: 369 bp
ATGGCAAAGATCATAGCCATTCTGATGCTATTACTGGTTGCTGGGTCAGCCATGGGAGATGGAGATGATCGTCCTAAAGTACCCTACTGCCCTATCGTCCTCGACAACTTGACCCCTTGCCTTCCTTACGTACTCGAAAATGAAGCGAAGCCAGCCAAGGTTTGCTGTAATGGCGTCCTAGACCTGAGCCACTCTGCAGGAAATAAGGAAGGTCGACAAAATATATGTGACTGCATCAAGGCTGAAGCTATTTTGATGAACATGCCTCTTGATAATTTTTCTAAATTTTCTTCTCTCCCTAAAGCCTGTGGCCTATTAATCAACCTTCCACCCATCTCCAATAACACCGATTGTTCCACGGTTGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LTP_2 Tryp_alpha_amyl

Protein Analysis

123

Amino Acids

13.02

Weight (kDa)

4.99

Isoelectric Point (pI)

35.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Tryp_alpha_amyl PF00234 30 - 118 4.3e-11 Protease inhibitor/seed storage/LTP family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015621)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g04531
malus_domestica MD06G1106400.v1.1 MD06G1106500.v1.1
prunus_persica Prupe.5G118600_v2.0.a1 Prupe.5G119200_v2.0.a1 Prupe.5G119400_v2.0.a1
rosa_chinensis RchiOBHm_Chr7g0194911
rosa_laevigata RLG00000004158
rosa_multiflora Rmu_ssc0000157.1_g000006
rosa_roxburghii Rroxscaffold_3G00260900
rosa_rugosa Rorug07G0018700
rosa_samantha Rh7AG146700 Rh7BG147400 Rh7CG150700 Rh7DG147900
rosa_wichuraiana Rw7G012520

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 214
AcsI RAATTY 1 cut(s) 284
AcuI CTGAAG 1 cut(s) 264
AcyI GRCGYC 1 cut(s) 174
AfaI GTAC 2 cut(s) 81, 132
AluBI AGCT 1 cut(s) 248
AluI AGCT 1 cut(s) 248
AoxI GGCC 1 cut(s) 310
ApoI RAATTY 1 cut(s) 284
AseI ATTAAT 1 cut(s) 317
BccI CCATC 2 cut(s) 53, 341
BfaI CTAG 1 cut(s) 179
BfmI CTRYAG 1 cut(s) 195
BmsI GCATC 2 cut(s) 15, 243
Bpu10I CCTNAGC 1 cut(s) 185
BsaAI YACGTR 1 cut(s) 130
BsaHI GRCGYC 1 cut(s) 174
BsaJI CCNNGG 3 cut(s) 51, 156, 357
Bse1I ACTGG 1 cut(s) 39
BseDI CCNNGG 3 cut(s) 51, 156, 357
BseMII CTCAG 1 cut(s) 176
BseNI ACTGG 1 cut(s) 39
BseYI CCCAGC 1 cut(s) 41
BshFI GGCC 1 cut(s) 312
BsnI GGCC 1 cut(s) 312
Bsp143I GATC 2 cut(s) 9, 67
Bsp19I CCATGG 1 cut(s) 51
BspANI GGCC 1 cut(s) 312
BspCNI CTCAG 1 cut(s) 177
BspMAI CTGCAG 1 cut(s) 199
BsrI ACTGG 1 cut(s) 39
BssECI CCNNGG 3 cut(s) 51, 156, 357
BssMI GATC 2 cut(s) 9, 67
BssNI GRCGYC 1 cut(s) 174
BssT1I CCWWGG 2 cut(s) 51, 156
Bst4CI ACNGT 1 cut(s) 361
BstACI GRCGYC 1 cut(s) 174
BstBAI YACGTR 1 cut(s) 130
BstC8I GCNNGC 1 cut(s) 153
BstDEI CTNAG 1 cut(s) 185
BstDSI CCRYGG 2 cut(s) 51, 357
BstKTI GATC 2 cut(s) 12, 70
BstMBI GATC 2 cut(s) 9, 67
BstMWI GCNNNNNNNGC 3 cut(s) 47, 152, 171
BstNSI RCATGY 1 cut(s) 265
BstSFI CTRYAG 1 cut(s) 195
BstSNI TACGTA 1 cut(s) 130
BsuRI GGCC 1 cut(s) 312
BtgI CCRYGG 2 cut(s) 51, 357
Cac8I GCNNGC 1 cut(s) 153
CseI GACGC 1 cut(s) 163
Csp6I GTAC 2 cut(s) 80, 131
CviAII CATG 2 cut(s) 52, 262
CviJI RGCY 9 cut(s) 17, 50, 151, 155, 189, 242, 248, 305, 312
CviKI_1 RGCY 9 cut(s) 17, 50, 151, 155, 189, 242, 248, 305, 312
CviQI GTAC 2 cut(s) 80, 131
DdeI CTNAG 1 cut(s) 185
DpnI GATC 2 cut(s) 11, 69
DpnII GATC 2 cut(s) 9, 67
Eco105I TACGTA 1 cut(s) 130
Eco130I CCWWGG 2 cut(s) 51, 156
Eco57I CTGAAG 1 cut(s) 264
EcoT14I CCWWGG 2 cut(s) 51, 156
ErhI CCWWGG 2 cut(s) 51, 156
FaeI CATG 2 cut(s) 55, 265
FaiI YATR 5 cut(s) 14, 53, 224, 226, 263
FatI CATG 2 cut(s) 51, 261
FblI GTMKAC 1 cut(s) 214
FspBI CTAG 1 cut(s) 179
GsaI CCCAGC 1 cut(s) 45
HaeIII GGCC 1 cut(s) 312
HgaI GACGC 1 cut(s) 163
Hin1I GRCGYC 1 cut(s) 174
Hin1II CATG 2 cut(s) 55, 265
HincII GTYRAC 1 cut(s) 215
HindII GTYRAC 1 cut(s) 215
Hpy166II GTNNAC 1 cut(s) 215
Hpy188I TCNGA 1 cut(s) 24
Hpy188III TCNNGA 1 cut(s) 269
Hpy8I GTNNAC 1 cut(s) 215
HpyAV CCTTC 3 cut(s) 131, 203, 335
HpyCH4III ACNGT 1 cut(s) 361
HpyCH4IV ACGT 1 cut(s) 129
HpyCH4V TGCA 2 cut(s) 197, 234
HpyF10VI GCNNNNNNNGC 3 cut(s) 47, 152, 171
HpyF3I CTNAG 1 cut(s) 185
HpySE526I ACGT 1 cut(s) 129
Hsp92I GRCGYC 1 cut(s) 174
Hsp92II CATG 2 cut(s) 55, 265
Kzo9I GATC 2 cut(s) 9, 67
LpnPI CCDG 6 cut(s) 20, 27, 165, 183, 197, 319
LweI GCATC 2 cut(s) 15, 243
MaeI CTAG 1 cut(s) 179
MaeII ACGT 1 cut(s) 129
MaeIII GTNAC 1 cut(s) 227
MalI GATC 2 cut(s) 11, 69
MboI GATC 2 cut(s) 9, 67
MboII GAAGA 1 cut(s) 282
MluCI AATT 2 cut(s) 274, 284
MnlI CCTC 2 cut(s) 110, 276
MseI TTAA 1 cut(s) 317
MslI CAYNNNNRTG 1 cut(s) 23
MwoI GCNNNNNNNGC 3 cut(s) 47, 152, 171
NcoI CCATGG 1 cut(s) 51
NdeII GATC 2 cut(s) 9, 67
NlaIII CATG 2 cut(s) 55, 265
NmuCI GTSAC 1 cut(s) 227
NspI RCATGY 1 cut(s) 265
Ppu21I YACGTR 1 cut(s) 130
PshBI ATTAAT 1 cut(s) 317
PspFI CCCAGC 1 cut(s) 41
PstI CTGCAG 1 cut(s) 199
RsaI GTAC 2 cut(s) 81, 132
RsaNI GTAC 2 cut(s) 80, 131
RseI CAYNNNNRTG 1 cut(s) 23
SalI GTCGAC 1 cut(s) 213
SaqAI TTAA 1 cut(s) 317
Sau3AI GATC 2 cut(s) 9, 67
SetI ASST 6 cut(s) 132, 162, 186, 214, 250, 327
SfaNI GCATC 2 cut(s) 15, 243
SfcI CTRYAG 1 cut(s) 195
SmiMI CAYNNNNRTG 1 cut(s) 23
SnaBI TACGTA 1 cut(s) 130
Sse9I AATT 2 cut(s) 274, 284
SspMI CTAG 1 cut(s) 179
StyI CCWWGG 2 cut(s) 51, 156
TaaI ACNGT 1 cut(s) 361
TaiI ACGT 1 cut(s) 132
TaqI TCGA 3 cut(s) 102, 135, 214
TasI AATT 2 cut(s) 274, 284
Tru1I TTAA 1 cut(s) 317
Tru9I TTAA 1 cut(s) 317
TseFI GTSAC 1 cut(s) 227
Tsp45I GTSAC 1 cut(s) 227
TspDTI ATGAA 2 cut(s) 156, 272
VspI ATTAAT 1 cut(s) 317
XapI RAATTY 1 cut(s) 284
XceI RCATGY 1 cut(s) 265
XmiI GTMKAC 1 cut(s) 214
XspI CTAG 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.