MD07G1039000.v1.1

RuBisCO catalyzes two reactions the carboxylation of D- ribulose 1,5-bisphosphate, the primary event in carbon dioxide fixation, as well as the oxidative fragmentation of the pentose substrate in the photorespiration process. Both reactions occur simultaneously and in competition at the same active site

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
OG0018283
Physical Location & Seq
Forward (+)
3289645 .. 3289839
195 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1039000.v1.1.491

Sequence Viewer

Length: 195 bp
ATGCTTATGTTAAAACTTTCCAAGGCCCGCCTCATGGTATCCAAGTTGAGAGAGAAGAATTATGGTAGAGCAGTTTATGAATGTCTATACGGTGGACTTGATTTTACCAAAGATGATGAGAATATTAATTCCCAACCATTTATGCGTTGGAGACCCATTTCTTATTTTTTTGCCGAAGCAATTTATAAAGCATAG

Protein Analysis

65

Amino Acids

7.62

Weight (kDa)

9.41

Isoelectric Point (pI)

41.16

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RuBisCO_large PF00016 16 - 64 4.6e-17 Ribulose bisphosphate carboxylase large chain, catalytic domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018283)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G07732 ATMG00280
malus_domestica MD07G1039000.v1.1 MD07G1110300.v1.1
rosa_chinensis RchiOBHm_Chr5g0043001
rosa_laevigata RLG00000030425
rosa_multiflora Rmu_sc0000239.1_g000052
rosa_samantha Rh5BG294900 Rh5DG304700
rosa_wichuraiana Rw5G025270

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 186
AciI CCGC 1 cut(s) 28
AfiI CCNNNNNNNGG 1 cut(s) 34
Alw26I GTCTC 1 cut(s) 145
AoxI GGCC 1 cut(s) 24
AseI ATTAAT 1 cut(s) 126
AspS9I GGNCC 1 cut(s) 25
BciVI GTATCC 1 cut(s) 49
BcoDI GTCTC 1 cut(s) 145
BfuI GTATCC 1 cut(s) 49
BmgT120I GGNCC 1 cut(s) 25
BsaI GGTCTC 1 cut(s) 145
BsaJI CCNNGG 1 cut(s) 21
Bsc4I CCNNNNNNNGG 1 cut(s) 34
BseDI CCNNGG 1 cut(s) 21
BseLI CCNNNNNNNGG 1 cut(s) 34
BshFI GGCC 1 cut(s) 26
BslI CCNNNNNNNGG 1 cut(s) 34
BsmAI GTCTC 1 cut(s) 145
BsnI GGCC 1 cut(s) 26
Bso31I GGTCTC 1 cut(s) 145
BspACI CCGC 1 cut(s) 28
BspANI GGCC 1 cut(s) 26
BspTNI GGTCTC 1 cut(s) 145
BssECI CCNNGG 1 cut(s) 21
BssT1I CCWWGG 1 cut(s) 21
Bst4CI ACNGT 1 cut(s) 92
BstC8I GCNNGC 1 cut(s) 28
BstMAI GTCTC 1 cut(s) 145
BsuI GTATCC 1 cut(s) 49
BsuRI GGCC 1 cut(s) 26
Cac8I GCNNGC 1 cut(s) 28
Cfr13I GGNCC 1 cut(s) 25
CviAII CATG 1 cut(s) 34
CviJI RGCY 1 cut(s) 26
CviKI_1 RGCY 1 cut(s) 26
Eco130I CCWWGG 1 cut(s) 21
Eco31I GGTCTC 1 cut(s) 145
EcoT14I CCWWGG 1 cut(s) 21
ErhI CCWWGG 1 cut(s) 21
FaeI CATG 1 cut(s) 37
FaiI YATR 8 cut(s) 8, 35, 63, 78, 88, 143, 186, 193
FatI CATG 1 cut(s) 33
FauI CCCGC 1 cut(s) 35
HaeIII GGCC 1 cut(s) 26
Hin1II CATG 1 cut(s) 37
Hpy166II GTNNAC 1 cut(s) 95
Hpy8I GTNNAC 1 cut(s) 95
HpyCH4III ACNGT 1 cut(s) 92
Hsp92II CATG 1 cut(s) 37
MboII GAAGA 1 cut(s) 67
MluCI AATT 3 cut(s) 58, 127, 180
MmeI TCCRAC 1 cut(s) 128
MnlI CCTC 1 cut(s) 41
MseI TTAA 2 cut(s) 11, 126
NlaIII CATG 1 cut(s) 37
PshBI ATTAAT 1 cut(s) 126
PsiI TTATAA 1 cut(s) 186
PspPI GGNCC 1 cut(s) 25
SaqAI TTAA 2 cut(s) 11, 126
Sau96I GGNCC 1 cut(s) 25
SgeI CNNG 5 cut(s) 34, 39, 46, 55, 110
Sse9I AATT 3 cut(s) 58, 127, 180
SsiI CCGC 1 cut(s) 28
SspI AATATT 1 cut(s) 124
StyI CCWWGG 1 cut(s) 21
TaaI ACNGT 1 cut(s) 92
TasI AATT 3 cut(s) 58, 127, 180
Tru1I TTAA 2 cut(s) 11, 126
Tru9I TTAA 2 cut(s) 11, 126
TspDTI ATGAA 1 cut(s) 93
VspI ATTAAT 1 cut(s) 126
XcmI CCANNNNNNNNNTGG 1 cut(s) 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.