MD07G1110300.v1.1

RuBisCO catalyzes two reactions the carboxylation of D- ribulose 1,5-bisphosphate, the primary event in carbon dioxide fixation, as well as the oxidative fragmentation of the pentose substrate in the photorespiration process. Both reactions occur simultaneously and in competition at the same active site

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
OG0018283
Physical Location & Seq
Forward (+)
12671485 .. 12671655
171 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1110300.v1.1.491

Sequence Viewer

Length: 171 bp
ATGCGTTGGATAGACCGTTTCTTATTTTGTGCCAAAGCAATTTATAAAGCACATGCTGAAATAGGTGAAATCAAAGGGCATTACTTAAACGCTACTGCATGTACATGTGAAGAGATGATCAAAAGAGCTGTATTTGCCAGAGAATTGGGGGTTCCAATCGTAATGCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00630 ko00710 ko01100 ko01120 ko01200 map00630 map00710 map01100 map01120 map01200
Pfam Domains
Protein Families
RuBisCO_large RuBisCO_large_N

Protein Analysis

57

Amino Acids

6.43

Weight (kDa)

8.57

Isoelectric Point (pI)

51.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RuBisCO_large PF00016 1 - 55 4.3e-14 Ribulose bisphosphate carboxylase large chain, catalytic domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018283)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G07732 ATMG00280
malus_domestica MD07G1039000.v1.1 MD07G1110300.v1.1
rosa_chinensis RchiOBHm_Chr5g0043001
rosa_laevigata RLG00000030425
rosa_multiflora Rmu_sc0000239.1_g000052
rosa_samantha Rh5BG294900 Rh5DG304700
rosa_wichuraiana Rw5G025270

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 45
AfaI GTAC 1 cut(s) 103
AflIII ACRYGT 1 cut(s) 104
AluBI AGCT 1 cut(s) 128
AluI AGCT 1 cut(s) 128
AsuHPI GGTGA 1 cut(s) 77
BclI TGATCA 1 cut(s) 117
BmiI GGNNCC 1 cut(s) 153
Bsp1407I TGTACA 1 cut(s) 101
Bsp143I GATC 1 cut(s) 117
BspLI GGNNCC 1 cut(s) 153
BsrGI TGTACA 1 cut(s) 101
BssMI GATC 1 cut(s) 117
Bst4CI ACNGT 1 cut(s) 17
Bst6I CTCTTC 1 cut(s) 105
BstAUI TGTACA 1 cut(s) 101
BstKTI GATC 1 cut(s) 120
BstMBI GATC 1 cut(s) 117
BstMWI GCNNNNNNNGC 1 cut(s) 134
BstNSI RCATGY 3 cut(s) 56, 102, 108
BstXI CCANNNNNNTGG 1 cut(s) 145
Csp6I GTAC 1 cut(s) 102
CviAII CATG 3 cut(s) 53, 99, 105
CviJI RGCY 1 cut(s) 128
CviKI_1 RGCY 1 cut(s) 128
CviQI GTAC 1 cut(s) 102
DpnI GATC 1 cut(s) 119
DpnII GATC 1 cut(s) 117
Eam1104I CTCTTC 1 cut(s) 105
EarI CTCTTC 1 cut(s) 105
FaeI CATG 3 cut(s) 56, 102, 108
FaiI YATR 4 cut(s) 45, 54, 100, 106
FatI CATG 3 cut(s) 52, 98, 104
FbaI TGATCA 1 cut(s) 117
Hin1II CATG 3 cut(s) 56, 102, 108
HphI GGTGA 1 cut(s) 77
HpyCH4III ACNGT 1 cut(s) 17
HpyCH4V TGCA 1 cut(s) 98
HpyF10VI GCNNNNNNNGC 1 cut(s) 134
Hsp92II CATG 3 cut(s) 56, 102, 108
Ksp22I TGATCA 1 cut(s) 117
Kzo9I GATC 1 cut(s) 117
LpnPI CCDG 1 cut(s) 151
MalI GATC 1 cut(s) 119
MboI GATC 1 cut(s) 117
MboII GAAGA 1 cut(s) 122
MluCI AATT 2 cut(s) 39, 143
MseI TTAA 1 cut(s) 86
MslI CAYNNNNRTG 1 cut(s) 103
MwoI GCNNNNNNNGC 1 cut(s) 134
NdeII GATC 1 cut(s) 117
NlaIII CATG 3 cut(s) 56, 102, 108
NlaIV GGNNCC 1 cut(s) 153
NspI RCATGY 3 cut(s) 56, 102, 108
PciI ACATGT 1 cut(s) 104
PscI ACATGT 1 cut(s) 104
PsiI TTATAA 1 cut(s) 45
PspN4I GGNNCC 1 cut(s) 153
RsaI GTAC 1 cut(s) 103
RsaNI GTAC 1 cut(s) 102
RseI CAYNNNNRTG 1 cut(s) 103
SaqAI TTAA 1 cut(s) 86
Sau3AI GATC 1 cut(s) 117
SetI ASST 2 cut(s) 67, 130
SgeI CNNG 4 cut(s) 65, 111, 117, 150
SmiMI CAYNNNNRTG 1 cut(s) 103
Sse9I AATT 2 cut(s) 39, 143
TaaI ACNGT 1 cut(s) 17
TasI AATT 2 cut(s) 39, 143
TatI WGTACW 1 cut(s) 101
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
XceI RCATGY 3 cut(s) 56, 102, 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.