MD07G1076600.v1.1

protein polyubiquitination

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
OG0013108
Physical Location & Seq
Forward (+)
7295782 .. 7299190
3409 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1076600.v1.1.491

Sequence Viewer

Length: 273 bp
ATGGGAAGGGGAGTAATTTGGGCGACGGCGGAGGACTTGGCAAGAAACAGAGGACGCGTCCTCTCTCTGTATCGCCAGATACTCAGAAGCCTCAACTCGCCTAGCTTGCCGCTGAATCTGGCCGCAAGGCTGGCCAAGAAAGCGGAGGCGCGCGCAATCTTCATGTTGGCGGCGGAGGAGAGGTCCCTTCACAACATTGACGACCTCGTTGATGCCGCTCATTACTCTCTCTCCCTCTTGAGGAAGGGGGAATTACCCAAATACATTCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.1

Weight (kDa)

10.09

Isoelectric Point (pI)

49.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LYRM_2 PF23655 12 - 81 1.2e-40 LYR motif containing domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 218
AccII CGCG 3 cut(s) 57, 151, 153
AciI CCGC 7 cut(s) 29, 110, 123, 143, 170, 173, 216
AcoI YGGCCR 2 cut(s) 120, 132
AfiI CCNNNNNNNGG 1 cut(s) 240
AflIII ACRYGT 1 cut(s) 55
AgsI TTSAA 1 cut(s) 269
AluBI AGCT 1 cut(s) 105
AluI AGCT 1 cut(s) 105
AoxI GGCC 2 cut(s) 120, 132
AspLEI GCGC 3 cut(s) 151, 153, 155
AspS9I GGNCC 1 cut(s) 183
AvaII GGWCC 1 cut(s) 183
BalI TGGCCA 1 cut(s) 134
BceAI ACGGC 1 cut(s) 42
BfaI CTAG 1 cut(s) 102
BisI GCNGC 4 cut(s) 110, 123, 171, 216
BlsI GCNGC 4 cut(s) 111, 124, 172, 217
Bme18I GGWCC 1 cut(s) 183
BmgT120I GGNCC 1 cut(s) 183
BmiI GGNNCC 1 cut(s) 185
BmsI GCATC 1 cut(s) 202
BpuEI CTTGAG 1 cut(s) 259
BsaXI ACNNNNNCTCC 4 cut(s) 167, 197, 215, 245
Bsc4I CCNNNNNNNGG 1 cut(s) 240
BseLI CCNNNNNNNGG 1 cut(s) 240
BseMII CTCAG 1 cut(s) 97
BsePI GCGCGC 2 cut(s) 149, 151
BseRI GAGGAG 1 cut(s) 191
Bsh1236I CGCG 3 cut(s) 57, 151, 153
BshFI GGCC 2 cut(s) 122, 134
BslFI GGGAC 1 cut(s) 169
BslI CCNNNNNNNGG 1 cut(s) 240
BsmFI GGGAC 1 cut(s) 169
BsnI GGCC 2 cut(s) 122, 134
BspACI CCGC 7 cut(s) 29, 110, 123, 143, 170, 173, 216
BspANI GGCC 2 cut(s) 122, 134
BspCNI CTCAG 1 cut(s) 96
BspFNI CGCG 3 cut(s) 57, 151, 153
BspLI GGNNCC 1 cut(s) 185
BsrBI CCGCTC 1 cut(s) 218
BssHII GCGCGC 2 cut(s) 149, 151
BstC8I GCNNGC 4 cut(s) 107, 132, 151, 153
BstDEI CTNAG 1 cut(s) 83
BstFNI CGCG 3 cut(s) 57, 151, 153
BstHHI GCGC 3 cut(s) 151, 153, 155
BstMWI GCNNNNNNNGC 3 cut(s) 106, 131, 140
BstUI CGCG 3 cut(s) 57, 151, 153
BsuRI GGCC 2 cut(s) 122, 134
Cac8I GCNNGC 4 cut(s) 107, 132, 151, 153
CfoI GCGC 3 cut(s) 151, 153, 155
Cfr13I GGNCC 1 cut(s) 183
CseI GACGC 2 cut(s) 46, 63
CviAII CATG 1 cut(s) 163
CviJI RGCY 5 cut(s) 90, 105, 122, 130, 134
CviKI_1 RGCY 5 cut(s) 90, 105, 122, 130, 134
DdeI CTNAG 1 cut(s) 83
EaeI YGGCCR 2 cut(s) 120, 132
EciI GGCGGA 2 cut(s) 44, 188
Eco47I GGWCC 1 cut(s) 183
EcoO109I RGGNCCY 1 cut(s) 183
FaeI CATG 1 cut(s) 166
FaiI YATR 1 cut(s) 164
FaqI GGGAC 1 cut(s) 169
FatI CATG 1 cut(s) 162
Fnu4HI GCNGC 4 cut(s) 110, 123, 171, 216
Fsp4HI GCNGC 4 cut(s) 110, 123, 171, 216
FspBI CTAG 1 cut(s) 102
GlaI GCGC 3 cut(s) 150, 152, 154
GluI GCNGC 4 cut(s) 110, 123, 171, 216
HaeIII GGCC 2 cut(s) 122, 134
HgaI GACGC 2 cut(s) 46, 63
HhaI GCGC 3 cut(s) 151, 153, 155
Hin1II CATG 1 cut(s) 166
Hin6I GCGC 3 cut(s) 149, 151, 153
HinP1I GCGC 3 cut(s) 149, 151, 153
HinfI GANTC 1 cut(s) 115
Hpy188I TCNGA 1 cut(s) 86
Hpy188III TCNNGA 1 cut(s) 238
Hpy99I CGWCG 1 cut(s) 28
HpyAV CCTTC 2 cut(s) 197, 238
HpyF10VI GCNNNNNNNGC 3 cut(s) 106, 131, 140
HpyF3I CTNAG 1 cut(s) 83
Hsp92II CATG 1 cut(s) 166
HspAI GCGC 3 cut(s) 149, 151, 153
LpnPI CCDG 3 cut(s) 89, 104, 116
LweI GCATC 1 cut(s) 202
MaeI CTAG 1 cut(s) 102
MbiI CCGCTC 1 cut(s) 218
MboII GAAGA 1 cut(s) 151
MlsI TGGCCA 1 cut(s) 134
MluCI AATT 2 cut(s) 15, 251
MluI ACGCGT 1 cut(s) 55
MluNI TGGCCA 1 cut(s) 134
Mox20I TGGCCA 1 cut(s) 134
MscI TGGCCA 1 cut(s) 134
Msp20I TGGCCA 1 cut(s) 134
MspA1I CMGCKG 1 cut(s) 112
MvnI CGCG 3 cut(s) 57, 151, 153
MwoI GCNNNNNNNGC 3 cut(s) 106, 131, 140
NlaIII CATG 1 cut(s) 166
NlaIV GGNNCC 1 cut(s) 185
PauI GCGCGC 2 cut(s) 149, 151
PfeI GAWTC 1 cut(s) 115
PkrI GCNGC 4 cut(s) 111, 124, 172, 217
PpuMI RGGWCCY 1 cut(s) 183
Psp5II RGGWCCY 1 cut(s) 183
PspN4I GGNNCC 1 cut(s) 185
PspPI GGNCC 1 cut(s) 183
PspPPI RGGWCCY 1 cut(s) 183
PteI GCGCGC 2 cut(s) 149, 151
SatI GCNGC 4 cut(s) 110, 123, 171, 216
Sau96I GGNCC 1 cut(s) 183
SetI ASST 3 cut(s) 107, 185, 207
SfaNI GCATC 1 cut(s) 202
SinI GGWCC 1 cut(s) 183
SmlI CTYRAG 1 cut(s) 238
SmoI CTYRAG 1 cut(s) 238
Sse9I AATT 2 cut(s) 15, 251
SsiI CCGC 7 cut(s) 29, 110, 123, 143, 170, 173, 216
SspMI CTAG 1 cut(s) 102
TasI AATT 2 cut(s) 15, 251
TauI GCSGC 4 cut(s) 112, 125, 173, 218
TfiI GAWTC 1 cut(s) 115
TspDTI ATGAA 1 cut(s) 151
VpaK11BI GGWCC 1 cut(s) 183
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.