Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009742.1

Orthogroup ID

OG0013108

Physical Location & Seq

Genomic Coordinates Reverse (-)

47852 .. 48124

Gene Structure 273 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009742.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 273 bp

atgagtgggggtttgatatgggcaacggcagaggacttggccagaaacagaggacgcgttctttctctgtatcgccagatattgagaagcatcaattctccgaatctgcctctgaatttggcagcaagactcgccaagaaagcagaggtgcgcgcaatcttcatggtggcttctgaggagaggtccctgcacaacattgaagacctcattgatgctgccaactactctctatccctcttgaggaaaggagagatacccaagtatattcaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

90

Amino Acids

10.11

Weight (kDa)

9.86

Isoelectric Point (pI)

60.84

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013108)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G65032
fragaria_vesca	FvH4_7g07070 FvH4_7g07070 FvH4_7g07070
malus_domestica	MD02G1240300.v1.1 MD07G1076600.v1.1
prunus_persica	Prupe.2G097300_v2.0.a1 Prupe.2G097300_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0337021
rosa_multiflora	Rmu_sc0009742.1_g000010
rosa_roxburghii	Rroxscaffold_154G00447970 Rroxscaffold_2G00156250 Rroxscaffold_3G00218050 Rroxscaffold_4G00315030
rosa_rugosa	Rorug01G0130600
rosa_samantha	Rh1AG150900 Rh1BG119300
rosa_wichuraiana	Rw1G012350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	2 cut(s)	57, 153
AcoI	YGGCCR	1 cut(s)	39
AcsI	RAATTY	1 cut(s)	115
AfiI	CCNNNNNNNGG	1 cut(s)	240
AflIII	ACRYGT	1 cut(s)	55
AgsI	TTSAA	2 cut(s)	200, 269
AoxI	GGCC	1 cut(s)	39
ApeKI	GCWGC	2 cut(s)	122, 215
ApoI	RAATTY	1 cut(s)	115
AspLEI	GCGC	2 cut(s)	153, 155
AspS9I	GGNCC	1 cut(s)	183
AvaII	GGWCC	1 cut(s)	183
BaeI	ACNNNNGTAYC	1 cut(s)	245
BalI	TGGCCA	1 cut(s)	41
BbsI	GAAGAC	1 cut(s)	207
BbvI	GCAGC	2 cut(s)	134, 202
BceAI	ACGGC	1 cut(s)	42
BisI	GCNGC	2 cut(s)	123, 216
BlsI	GCNGC	2 cut(s)	124, 217
Bme18I	GGWCC	1 cut(s)	183
BmgT120I	GGNCC	1 cut(s)	183
BmiI	GGNNCC	1 cut(s)	185
BmsI	GCATC	2 cut(s)	99, 202
BpiI	GAAGAC	1 cut(s)	207
BpuEI	CTTGAG	1 cut(s)	259
Bsc4I	CCNNNNNNNGG	1 cut(s)	240
BseLI	CCNNNNNNNGG	1 cut(s)	240
BseMII	CTCAG	1 cut(s)	165
BsePI	GCGCGC	1 cut(s)	151
BseRI	GAGGAG	1 cut(s)	191
BseXI	GCAGC	2 cut(s)	134, 202
BsgI	GTGCAG	1 cut(s)	173
Bsh1236I	CGCG	2 cut(s)	57, 153
BshFI	GGCC	1 cut(s)	41
BslFI	GGGAC	1 cut(s)	169
BslI	CCNNNNNNNGG	1 cut(s)	240
BsmFI	GGGAC	1 cut(s)	169
BsnI	GGCC	1 cut(s)	41
BspANI	GGCC	1 cut(s)	41
BspCNI	CTCAG	1 cut(s)	166
BspFNI	CGCG	2 cut(s)	57, 153
BspLI	GGNNCC	1 cut(s)	185
BssHII	GCGCGC	1 cut(s)	151
BstC8I	GCNNGC	1 cut(s)	153
BstDEI	CTNAG	1 cut(s)	174
BstFNI	CGCG	2 cut(s)	57, 153
BstHHI	GCGC	2 cut(s)	153, 155
BstMWI	GCNNNNNNNGC	2 cut(s)	131, 140
BstUI	CGCG	2 cut(s)	57, 153
BstV1I	GCAGC	2 cut(s)	134, 202
BstV2I	GAAGAC	1 cut(s)	207
BsuRI	GGCC	1 cut(s)	41
Cac8I	GCNNGC	1 cut(s)	153
CfoI	GCGC	2 cut(s)	153, 155
Cfr13I	GGNCC	1 cut(s)	183
CseI	GACGC	1 cut(s)	63
CviAII	CATG	1 cut(s)	163
CviJI	RGCY	2 cut(s)	41, 170
CviKI_1	RGCY	2 cut(s)	41, 170
DdeI	CTNAG	1 cut(s)	174
EaeI	YGGCCR	1 cut(s)	39
Eco47I	GGWCC	1 cut(s)	183
EcoO109I	RGGNCCY	1 cut(s)	183
FaeI	CATG	1 cut(s)	166
FaiI	YATR	3 cut(s)	19, 164, 264
FaqI	GGGAC	1 cut(s)	169
FatI	CATG	1 cut(s)	162
Fnu4HI	GCNGC	2 cut(s)	123, 216
Fsp4HI	GCNGC	2 cut(s)	123, 216
GlaI	GCGC	2 cut(s)	152, 154
GluI	GCNGC	2 cut(s)	123, 216
HaeIII	GGCC	1 cut(s)	41
HgaI	GACGC	1 cut(s)	63
HhaI	GCGC	2 cut(s)	153, 155
Hin1II	CATG	1 cut(s)	166
Hin6I	GCGC	2 cut(s)	151, 153
HinP1I	GCGC	2 cut(s)	151, 153
HinfI	GANTC	2 cut(s)	103, 129
Hpy188I	TCNGA	3 cut(s)	102, 114, 175
Hpy188III	TCNNGA	1 cut(s)	238
HpyCH4V	TGCA	1 cut(s)	190
HpyF10VI	GCNNNNNNNGC	2 cut(s)	131, 140
HpyF3I	CTNAG	1 cut(s)	174
Hsp92II	CATG	1 cut(s)	166
HspAI	GCGC	2 cut(s)	151, 153
LpnPI	CCDG	3 cut(s)	55, 89, 200
Lsp1109I	GCAGC	2 cut(s)	134, 202
LweI	GCATC	2 cut(s)	99, 202
MboII	GAAGA	2 cut(s)	151, 212
MlsI	TGGCCA	1 cut(s)	41
MluCI	AATT	2 cut(s)	94, 115
MluI	ACGCGT	1 cut(s)	55
MluNI	TGGCCA	1 cut(s)	41
MlyI	GAGTC	1 cut(s)	123
MnlI	CCTC	9 cut(s)	25, 44, 120, 139, 169, 174, 215, 234, 245
Mox20I	TGGCCA	1 cut(s)	41
MscI	TGGCCA	1 cut(s)	41
Msp20I	TGGCCA	1 cut(s)	41
MvnI	CGCG	2 cut(s)	57, 153
MwoI	GCNNNNNNNGC	2 cut(s)	131, 140
NlaIII	CATG	1 cut(s)	166
NlaIV	GGNNCC	1 cut(s)	185
PauI	GCGCGC	1 cut(s)	151
PfeI	GAWTC	1 cut(s)	103
PkrI	GCNGC	2 cut(s)	124, 217
PleI	GAGTC	1 cut(s)	123
PpsI	GAGTC	1 cut(s)	123
PpuMI	RGGWCCY	1 cut(s)	183
Psp5II	RGGWCCY	1 cut(s)	183
PspN4I	GGNNCC	1 cut(s)	185
PspPI	GGNCC	1 cut(s)	183
PspPPI	RGGWCCY	1 cut(s)	183
PteI	GCGCGC	1 cut(s)	151
SatI	GCNGC	2 cut(s)	123, 216
Sau96I	GGNCC	1 cut(s)	183
SchI	GAGTC	1 cut(s)	123
SetI	ASST	3 cut(s)	150, 185, 207
SfaNI	GCATC	2 cut(s)	99, 202
SinI	GGWCC	1 cut(s)	183
SmlI	CTYRAG	1 cut(s)	238
SmoI	CTYRAG	1 cut(s)	238
Sse9I	AATT	2 cut(s)	94, 115
TasI	AATT	2 cut(s)	94, 115
TfiI	GAWTC	1 cut(s)	103
TseI	GCWGC	2 cut(s)	122, 215
TspDTI	ATGAA	1 cut(s)	151
VpaK11BI	GGWCC	1 cut(s)	183
XapI	RAATTY	1 cut(s)	115

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.