MD08G1182000.v1.1

Annexin D1-like

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
Physical Location & Seq
Reverse (-)
22569563 .. 22570161
599 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1182000.v1.1.491

Sequence Viewer

Length: 153 bp
ATGAAGATTATCAAGGACCTGTACCACAAAAGGAACAGCGTCCCTCTGTATCAGGCCATTAAAGAAGACACTACTTTAATGCATCTTTCTTGTAGGAGCAAGGCAATATATTTGAATCCGATATGTTCTACTTACGACAGATACTCAAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

51

Amino Acids

5.91

Weight (kDa)

9.3

Isoelectric Point (pI)

57.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014753)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 23
AgsI TTSAA 1 cut(s) 115
AoxI GGCC 1 cut(s) 54
AspS9I GGNCC 1 cut(s) 16
AvaII GGWCC 1 cut(s) 16
BaeI ACNNNNGTAYC 1 cut(s) 133
BbsI GAAGAC 1 cut(s) 72
Bme18I GGWCC 1 cut(s) 16
BmgT120I GGNCC 1 cut(s) 16
BmsI GCATC 1 cut(s) 91
BpiI GAAGAC 1 cut(s) 72
BpuEI CTTGAG 1 cut(s) 130
BshFI GGCC 1 cut(s) 56
BslFI GGGAC 1 cut(s) 26
BsmFI GGGAC 1 cut(s) 26
BsnI GGCC 1 cut(s) 56
BspANI GGCC 1 cut(s) 56
BstV2I GAAGAC 1 cut(s) 72
BsuRI GGCC 1 cut(s) 56
Cfr13I GGNCC 1 cut(s) 16
CseI GACGC 1 cut(s) 28
Csp6I GTAC 1 cut(s) 22
CviJI RGCY 1 cut(s) 56
CviKI_1 RGCY 1 cut(s) 56
CviQI GTAC 1 cut(s) 22
Eco47I GGWCC 1 cut(s) 16
EcoO109I RGGNCCY 1 cut(s) 16
EcoT22I ATGCAT 1 cut(s) 84
FaiI YATR 2 cut(s) 109, 124
FaqI GGGAC 1 cut(s) 26
HaeIII GGCC 1 cut(s) 56
HgaI GACGC 1 cut(s) 28
HinfI GANTC 1 cut(s) 115
Hpy188I TCNGA 1 cut(s) 120
HpyCH4V TGCA 1 cut(s) 82
LmnI GCTCC 1 cut(s) 96
LpnPI CCDG 2 cut(s) 32, 38
LweI GCATC 1 cut(s) 91
MboII GAAGA 2 cut(s) 16, 77
MnlI CCTC 1 cut(s) 54
Mph1103I ATGCAT 1 cut(s) 84
MseI TTAA 3 cut(s) 60, 77, 151
NsiI ATGCAT 1 cut(s) 84
PfeI GAWTC 1 cut(s) 115
PpuMI RGGWCCY 1 cut(s) 16
Psp5II RGGWCCY 1 cut(s) 16
PspPI GGNCC 1 cut(s) 16
PspPPI RGGWCCY 1 cut(s) 16
RsaI GTAC 1 cut(s) 23
RsaNI GTAC 1 cut(s) 22
SaqAI TTAA 3 cut(s) 60, 77, 151
Sau96I GGNCC 1 cut(s) 16
SetI ASST 1 cut(s) 21
SfaNI GCATC 1 cut(s) 91
SgeI CNNG 5 cut(s) 25, 31, 65, 102, 112
SinI GGWCC 1 cut(s) 16
SmlI CTYRAG 1 cut(s) 145
SmoI CTYRAG 1 cut(s) 145
TfiI GAWTC 1 cut(s) 115
Tru1I TTAA 3 cut(s) 60, 77, 151
Tru9I TTAA 3 cut(s) 60, 77, 151
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 16
Zsp2I ATGCAT 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.