MD08G1221200.v1.1

Chaperone protein dnaJ 20, chloroplastic-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
OG0016939
Physical Location & Seq
Forward (+)
28386787 .. 28387332
546 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1221200.v1.1.491

Sequence Viewer

Length: 546 bp
ATGAATACTTCTCTGCTAACTTCAAGCTACGAAAACCCTAGCACCAGTGCTGCAGCTGCTAACCCTAAACCTTTTTTAACTTGTCATGCACGCAAAGTCACTAAAATTACATGCAGAGCCACAAATAATTACGAGAGCGATAGTACTAATAGTACCAATTTCTACAAACTACTTAATTTGAGTCCGAATACTAACACGAGCAAAGACGAGATCAAGCGAGCTTACAGAAGCATGGCGCTTCGCTATCATCCAGATGTATGTCACGATCAACATTATTCCAATATTTCCACCGAACGATTTGTTCAACTGAACGAGGCTTACAAGACGCTATCGGATCCTCTGTTGCGCGACGAATATGATTACATGTTGGGTTTGAAAGATTATTGTAGGAGCAGCACCTTCAACATGGATAATTCTATTAGATATGATCGAGGTGCAGAAAATAGATGGCGCCAACAAATTCTTGAGTTGAACAGAAGGTCACAAAAGGAAGGATCATGGGCCAGCAGAATAAGGAGAGGTCGCGATATTTCAACTATGGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DnaJ

Protein Analysis

182

Amino Acids

21.09

Weight (kDa)

9.17

Isoelectric Point (pI)

49.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DnaJ PF00226 53 - 120 2.1e-18 DnaJ domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016939)

Species Orthologous Gene IDs
malus_domestica MD08G1221200.v1.1
prunus_persica Prupe.1G558200_v2.0.a1
pyrus_communis pycom15g36670
rosa_chinensis RchiOBHm_Chr7g0226211
rosa_laevigata RLG00000001758
rosa_multiflora Rmu_sc0001350.1_g000004 Rmu_sc0013267.1_g000006
rosa_roxburghii Rroxscaffold_3G00233120
rosa_rugosa Rorug07G0235700
rosa_samantha Rh7AG382600 Rh7BG369800 Rh7CG402100 Rh7DG381000
rosa_wichuraiana Rw7G032060

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 450
AccII CGCG 2 cut(s) 348, 525
AclWI GGATC 3 cut(s) 329, 342, 502
AcsI RAATTY 1 cut(s) 459
AcyI GRCGYC 1 cut(s) 451
AfaI GTAC 2 cut(s) 145, 154
AflIII ACRYGT 1 cut(s) 363
AgsI TTSAA 6 cut(s) 24, 305, 376, 403, 472, 534
AluBI AGCT 3 cut(s) 27, 56, 221
AluI AGCT 3 cut(s) 27, 56, 221
AlwI GGATC 3 cut(s) 329, 342, 502
AoxI GGCC 1 cut(s) 501
ApeKI GCWGC 4 cut(s) 50, 53, 56, 393
ApoI RAATTY 1 cut(s) 459
AspLEI GCGC 3 cut(s) 238, 348, 453
AspS9I GGNCC 1 cut(s) 501
BamHI GGATCC 1 cut(s) 334
BanI GGYRCC 1 cut(s) 450
BauI CACGAG 1 cut(s) 196
BbvI GCAGC 4 cut(s) 37, 43, 65, 405
BccI CCATC 1 cut(s) 441
BfaI CTAG 2 cut(s) 39, 544
BfmI CTRYAG 1 cut(s) 51
BfoI RGCGCY 2 cut(s) 239, 454
BisI GCNGC 4 cut(s) 51, 54, 57, 394
BlsI GCNGC 4 cut(s) 52, 55, 58, 395
BmcAI AGTACT 1 cut(s) 145
BmgT120I GGNCC 1 cut(s) 501
BmiI GGNNCC 2 cut(s) 336, 452
BpuEI CTTGAG 1 cut(s) 485
BsaHI GRCGYC 1 cut(s) 451
Bse1I ACTGG 1 cut(s) 45
BseGI GGATG 1 cut(s) 247
BseNI ACTGG 1 cut(s) 45
BseXI GCAGC 4 cut(s) 37, 43, 65, 405
BsgI GTGCAG 1 cut(s) 456
Bsh1236I CGCG 2 cut(s) 348, 525
BshFI GGCC 1 cut(s) 503
BshNI GGYRCC 1 cut(s) 450
BsnI GGCC 1 cut(s) 503
Bsp143I GATC 5 cut(s) 210, 265, 334, 427, 494
Bsp68I TCGCGA 1 cut(s) 525
BspANI GGCC 1 cut(s) 503
BspFNI CGCG 2 cut(s) 348, 525
BspLI GGNNCC 2 cut(s) 336, 452
BspMAI CTGCAG 1 cut(s) 55
BspPI GGATC 3 cut(s) 329, 342, 502
BspT107I GGYRCC 1 cut(s) 450
BsrI ACTGG 1 cut(s) 45
BssMI GATC 5 cut(s) 210, 265, 334, 427, 494
BssNI GRCGYC 1 cut(s) 451
BssSI CACGAG 1 cut(s) 196
Bst2BI CACGAG 1 cut(s) 196
BstACI GRCGYC 1 cut(s) 451
BstC8I GCNNGC 3 cut(s) 91, 219, 505
BstF5I GGATG 1 cut(s) 247
BstFNI CGCG 2 cut(s) 348, 525
BstH2I RGCGCY 2 cut(s) 239, 454
BstHHI GCGC 3 cut(s) 238, 348, 453
BstKTI GATC 5 cut(s) 213, 268, 337, 430, 497
BstMBI GATC 5 cut(s) 210, 265, 334, 427, 494
BstMWI GCNNNNNNNGC 1 cut(s) 56
BstNSI RCATGY 2 cut(s) 114, 367
BstSFI CTRYAG 1 cut(s) 51
BstUI CGCG 2 cut(s) 348, 525
BstV1I GCAGC 4 cut(s) 37, 43, 65, 405
BstX2I RGATCY 1 cut(s) 334
BstYI RGATCY 1 cut(s) 334
BsuRI GGCC 1 cut(s) 503
BtsCI GGATG 1 cut(s) 247
BtsIMutI CAGTG 1 cut(s) 52
BtuMI TCGCGA 1 cut(s) 525
Cac8I GCNNGC 3 cut(s) 91, 219, 505
CfoI GCGC 3 cut(s) 238, 348, 453
Cfr13I GGNCC 1 cut(s) 501
CseI GACGC 1 cut(s) 334
Csp6I GTAC 2 cut(s) 144, 153
CviAII CATG 6 cut(s) 86, 111, 232, 364, 406, 498
CviJI RGCY 6 cut(s) 27, 56, 119, 221, 317, 503
CviKI_1 RGCY 6 cut(s) 27, 56, 119, 221, 317, 503
CviQI GTAC 2 cut(s) 144, 153
DinI GGCGCC 1 cut(s) 452
DpnI GATC 5 cut(s) 212, 267, 336, 429, 496
DpnII GATC 5 cut(s) 210, 265, 334, 427, 494
EgeI GGCGCC 1 cut(s) 452
EheI GGCGCC 1 cut(s) 452
FaeI CATG 6 cut(s) 89, 114, 235, 367, 409, 501
FatI CATG 6 cut(s) 85, 110, 231, 363, 405, 497
Fnu4HI GCNGC 4 cut(s) 51, 54, 57, 394
FokI GGATG 1 cut(s) 234
Fsp4HI GCNGC 4 cut(s) 51, 54, 57, 394
FspBI CTAG 2 cut(s) 39, 544
GlaI GCGC 3 cut(s) 237, 347, 452
GluI GCNGC 4 cut(s) 51, 54, 57, 394
HaeII RGCGCY 2 cut(s) 239, 454
HaeIII GGCC 1 cut(s) 503
HgaI GACGC 1 cut(s) 334
HhaI GCGC 3 cut(s) 238, 348, 453
Hin1I GRCGYC 1 cut(s) 451
Hin1II CATG 6 cut(s) 89, 114, 235, 367, 409, 501
Hin6I GCGC 3 cut(s) 236, 346, 451
HinP1I GCGC 3 cut(s) 236, 346, 451
HinfI GANTC 1 cut(s) 181
Hpy188I TCNGA 2 cut(s) 186, 334
Hpy188III TCNNGA 4 cut(s) 251, 263, 464, 524
Hpy99I CGWCG 1 cut(s) 353
HpyAV CCTTC 3 cut(s) 409, 471, 485
HpyCH4V TGCA 4 cut(s) 53, 89, 114, 437
HpyF10VI GCNNNNNNNGC 1 cut(s) 56
Hsp92I GRCGYC 1 cut(s) 451
Hsp92II CATG 6 cut(s) 89, 114, 235, 367, 409, 501
HspAI GCGC 3 cut(s) 236, 346, 451
KasI GGCGCC 1 cut(s) 450
Kzo9I GATC 5 cut(s) 210, 265, 334, 427, 494
LmnI GCTCC 1 cut(s) 390
LpnPI CCDG 3 cut(s) 58, 264, 517
Lsp1109I GCAGC 4 cut(s) 37, 43, 65, 405
MaeI CTAG 2 cut(s) 39, 544
MaeIII GTNAC 3 cut(s) 97, 260, 480
MalI GATC 5 cut(s) 212, 267, 336, 429, 496
MboI GATC 5 cut(s) 210, 265, 334, 427, 494
MflI RGATCY 1 cut(s) 334
MluCI AATT 6 cut(s) 105, 127, 157, 175, 412, 459
Mly113I GGCGCC 1 cut(s) 451
MlyI GAGTC 1 cut(s) 190
MnlI CCTC 4 cut(s) 307, 348, 425, 512
MseI TTAA 2 cut(s) 77, 174
MslI CAYNNNNRTG 1 cut(s) 252
MspA1I CMGCKG 1 cut(s) 56
MvnI CGCG 2 cut(s) 348, 525
MwoI GCNNNNNNNGC 1 cut(s) 56
NarI GGCGCC 1 cut(s) 451
NdeII GATC 5 cut(s) 210, 265, 334, 427, 494
NlaIII CATG 6 cut(s) 89, 114, 235, 367, 409, 501
NlaIV GGNNCC 2 cut(s) 336, 452
NmuCI GTSAC 3 cut(s) 97, 260, 480
NruI TCGCGA 1 cut(s) 525
NspI RCATGY 2 cut(s) 114, 367
PciI ACATGT 1 cut(s) 363
PkrI GCNGC 4 cut(s) 52, 55, 58, 395
PleI GAGTC 1 cut(s) 189
PluTI GGCGCC 1 cut(s) 454
PpsI GAGTC 1 cut(s) 189
PscI ACATGT 1 cut(s) 363
PspN4I GGNNCC 2 cut(s) 336, 452
PspPI GGNCC 1 cut(s) 501
PsrI GAACNNNNNNTAC 2 cut(s) 302, 334
PstI CTGCAG 1 cut(s) 55
PsuI RGATCY 1 cut(s) 334
PvuII CAGCTG 1 cut(s) 56
RruI TCGCGA 1 cut(s) 525
RsaI GTAC 2 cut(s) 145, 154
RsaNI GTAC 2 cut(s) 144, 153
RseI CAYNNNNRTG 1 cut(s) 252
SaqAI TTAA 2 cut(s) 77, 174
SatI GCNGC 4 cut(s) 51, 54, 57, 394
Sau3AI GATC 5 cut(s) 210, 265, 334, 427, 494
Sau96I GGNCC 1 cut(s) 501
ScaI AGTACT 1 cut(s) 145
SchI GAGTC 1 cut(s) 190
SetI ASST 8 cut(s) 29, 58, 73, 223, 401, 436, 482, 523
SfcI CTRYAG 1 cut(s) 51
SfoI GGCGCC 1 cut(s) 452
SmiMI CAYNNNNRTG 1 cut(s) 252
SmlI CTYRAG 1 cut(s) 464
SmoI CTYRAG 1 cut(s) 464
Sse9I AATT 6 cut(s) 105, 127, 157, 175, 412, 459
SspDI GGCGCC 1 cut(s) 450
SspI AATATT 1 cut(s) 283
SspMI CTAG 2 cut(s) 39, 544
TaqI TCGA 1 cut(s) 430
TasI AATT 6 cut(s) 105, 127, 157, 175, 412, 459
TatI WGTACW 1 cut(s) 143
Tru1I TTAA 2 cut(s) 77, 174
Tru9I TTAA 2 cut(s) 77, 174
TscAI CASTG 1 cut(s) 52
TseFI GTSAC 3 cut(s) 97, 260, 480
TseI GCWGC 4 cut(s) 50, 53, 56, 393
Tsp45I GTSAC 3 cut(s) 97, 260, 480
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 52
XapI RAATTY 1 cut(s) 459
XceI RCATGY 2 cut(s) 114, 367
XspI CTAG 2 cut(s) 39, 544
ZrmI AGTACT 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.