MD09G1073800.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Forward (+)
5109691 .. 5110733
1043 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1073800.v1.1.491

Sequence Viewer

Length: 213 bp
ATGGATAACATAACGGCGAGCGAGCTGGCTGGATTTGGTGTCGGAACTCTGCTCCTCTGCGCCACCATTGCGGCCCCGAAAATCGACGCTTTCATCTCCGCCTCTCAGCGCAGTTCTTTGGGAATGTGCAAGAGATGTGGCAATCTGAGGTTGATAGCTTGCTCAAGATGCAAAGGAATTGGATTGATCAAAGAAGGTGAAATGCTCGGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

7.25

Weight (kDa)

8.75

Isoelectric Point (pI)

40.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010379)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 71, 99
AluBI AGCT 2 cut(s) 25, 158
AluI AGCT 2 cut(s) 25, 158
AoxI GGCC 1 cut(s) 72
AspLEI GCGC 2 cut(s) 62, 111
AspS9I GGNCC 1 cut(s) 73
AsuHPI GGTGA 1 cut(s) 209
BceAI ACGGC 1 cut(s) 30
BclI TGATCA 1 cut(s) 186
BisI GCNGC 1 cut(s) 72
BlsI GCNGC 1 cut(s) 73
BmgT120I GGNCC 1 cut(s) 73
BmiI GGNNCC 1 cut(s) 75
BmsI GCATC 1 cut(s) 158
BpuEI CTTGAG 1 cut(s) 148
Bse3DI GCAATG 1 cut(s) 66
BseMI GCAATG 1 cut(s) 66
BseMII CTCAG 2 cut(s) 119, 137
BseRI GAGGAG 1 cut(s) 44
BshFI GGCC 1 cut(s) 74
BsnI GGCC 1 cut(s) 74
Bsp143I GATC 1 cut(s) 186
BspACI CCGC 2 cut(s) 71, 99
BspANI GGCC 1 cut(s) 74
BspCNI CTCAG 2 cut(s) 118, 138
BspLI GGNNCC 1 cut(s) 75
BsrDI GCAATG 1 cut(s) 66
BssMI GATC 1 cut(s) 186
BstC8I GCNNGC 4 cut(s) 19, 23, 27, 160
BstDEI CTNAG 2 cut(s) 105, 146
BstHHI GCGC 2 cut(s) 62, 111
BstKTI GATC 1 cut(s) 189
BstMBI GATC 1 cut(s) 186
BstMWI GCNNNNNNNGC 2 cut(s) 68, 168
BsuRI GGCC 1 cut(s) 74
Cac8I GCNNGC 4 cut(s) 19, 23, 27, 160
CfoI GCGC 2 cut(s) 62, 111
Cfr13I GGNCC 1 cut(s) 73
CseI GACGC 1 cut(s) 95
CspCI CAANNNNNGTGG 2 cut(s) 118, 153
CviJI RGCY 4 cut(s) 25, 29, 74, 158
CviKI_1 RGCY 4 cut(s) 25, 29, 74, 158
DdeI CTNAG 2 cut(s) 105, 146
DpnI GATC 1 cut(s) 188
DpnII GATC 1 cut(s) 186
EciI GGCGGA 1 cut(s) 88
FaiI YATR 1 cut(s) 11
FbaI TGATCA 1 cut(s) 186
Fnu4HI GCNGC 1 cut(s) 72
Fsp4HI GCNGC 1 cut(s) 72
GlaI GCGC 2 cut(s) 61, 110
GluI GCNGC 1 cut(s) 72
HaeIII GGCC 1 cut(s) 74
HgaI GACGC 1 cut(s) 95
HhaI GCGC 2 cut(s) 62, 111
Hin6I GCGC 2 cut(s) 60, 109
HinP1I GCGC 2 cut(s) 60, 109
HphI GGTGA 1 cut(s) 209
Hpy188I TCNGA 3 cut(s) 44, 147, 209
Hpy188III TCNNGA 1 cut(s) 165
Hpy99I CGWCG 1 cut(s) 89
HpyAV CCTTC 1 cut(s) 188
HpyCH4V TGCA 2 cut(s) 129, 171
HpyF10VI GCNNNNNNNGC 2 cut(s) 68, 168
HpyF3I CTNAG 2 cut(s) 105, 146
HspAI GCGC 2 cut(s) 60, 109
Ksp22I TGATCA 1 cut(s) 186
Kzo9I GATC 1 cut(s) 186
LmnI GCTCC 1 cut(s) 57
LpnPI CCDG 2 cut(s) 11, 15
LweI GCATC 1 cut(s) 158
MalI GATC 1 cut(s) 188
MboI GATC 1 cut(s) 186
MluCI AATT 1 cut(s) 177
MmeI TCCRAC 1 cut(s) 22
MnlI CCTC 3 cut(s) 65, 112, 141
MwoI GCNNNNNNNGC 2 cut(s) 68, 168
NdeII GATC 1 cut(s) 186
NlaIV GGNNCC 1 cut(s) 75
PkrI GCNGC 1 cut(s) 73
PspN4I GGNNCC 1 cut(s) 75
PspPI GGNCC 1 cut(s) 73
SatI GCNGC 1 cut(s) 72
Sau3AI GATC 1 cut(s) 186
Sau96I GGNCC 1 cut(s) 73
SetI ASST 4 cut(s) 27, 152, 160, 199
SfaNI GCATC 1 cut(s) 158
SgeI CNNG 8 cut(s) 30, 34, 38, 42, 88, 142, 171, 177
SmlI CTYRAG 1 cut(s) 163
SmoI CTYRAG 1 cut(s) 163
Sse9I AATT 1 cut(s) 177
SsiI CCGC 2 cut(s) 71, 99
TaqI TCGA 1 cut(s) 84
TasI AATT 1 cut(s) 177
TauI GCSGC 1 cut(s) 74
TspDTI ATGAA 1 cut(s) 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.