RchiOBHm_Chr2g0164961

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
80015847 .. 80017464
1618 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53295

Sequence Viewer

Length: 381 bp
ATGTGTATACTTATCCACAGTCTGGGAGTGGATAGCAAACAAAAGGAGATGGACAACATAACTGCAAGCGAGCTGGCGGGTTTTGGAGTTGGAACTCTACTTCTCTGCGCCACCATTGCTGCTCCAAAGGTCGATGCTTTCATCTCTGGCTCTCAGCGCAGTTCTTTGGGAATGTGCAAGAGATGTGGTAATGTAAGGAAGATAGCATGCTCAACATGTAGAGGAACTGGATTGGTTAAGGAAGGTGGAGTAGCCGGTTTTAATCTCATTGATGACTTGTATCAATCGCTAGGGGGTGATGAATCGAAAGTAAGATCCATTGCTTGCACCAAATGTCAAGCTAAAGGTCATTTTAGCTGCCCTGATTGCTCTAAAACATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

126

Amino Acids

13.15

Weight (kDa)

8.56

Isoelectric Point (pI)

44.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010379)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 22
AccI GTMKAC 1 cut(s) 7
AciI CCGC 1 cut(s) 77
AclWI GGATC 1 cut(s) 309
AfiI CCNNNNNNNGG 1 cut(s) 22
AflIII ACRYGT 1 cut(s) 215
AluBI AGCT 3 cut(s) 73, 341, 357
AluI AGCT 3 cut(s) 73, 341, 357
AlwI GGATC 1 cut(s) 309
ApeKI GCWGC 2 cut(s) 119, 357
AspLEI GCGC 2 cut(s) 110, 159
AsuHPI GGTGA 1 cut(s) 308
BbvI GCAGC 2 cut(s) 106, 344
BccI CCATC 1 cut(s) 43
BfaI CTAG 1 cut(s) 290
BisI GCNGC 2 cut(s) 120, 358
BlsI GCNGC 2 cut(s) 121, 359
BmsI GCATC 1 cut(s) 124
Bsc4I CCNNNNNNNGG 1 cut(s) 22
Bse118I RCCGGY 1 cut(s) 254
Bse1I ACTGG 1 cut(s) 232
Bse3DI GCAATG 2 cut(s) 114, 318
BseLI CCNNNNNNNGG 1 cut(s) 22
BseMI GCAATG 2 cut(s) 114, 318
BseMII CTCAG 1 cut(s) 167
BseNI ACTGG 1 cut(s) 232
BseXI GCAGC 2 cut(s) 106, 344
BsiSI CCGG 1 cut(s) 255
BslI CCNNNNNNNGG 1 cut(s) 22
Bsp143I GATC 1 cut(s) 314
BspACI CCGC 1 cut(s) 77
BspCNI CTCAG 1 cut(s) 166
BspPI GGATC 1 cut(s) 309
BsrDI GCAATG 2 cut(s) 114, 318
BsrFI RCCGGY 1 cut(s) 254
BsrI ACTGG 1 cut(s) 232
BssAI RCCGGY 1 cut(s) 254
BssMI GATC 1 cut(s) 314
BssNAI GTATAC 1 cut(s) 8
Bst1107I GTATAC 1 cut(s) 8
Bst4CI ACNGT 1 cut(s) 20
BstC8I GCNNGC 5 cut(s) 67, 71, 75, 208, 325
BstDEI CTNAG 1 cut(s) 153
BstHHI GCGC 2 cut(s) 110, 159
BstKTI GATC 1 cut(s) 317
BstMBI GATC 1 cut(s) 314
BstMWI GCNNNNNNNGC 3 cut(s) 116, 156, 366
BstNSI RCATGY 2 cut(s) 210, 219
BstV1I GCAGC 2 cut(s) 106, 344
BstX2I RGATCY 1 cut(s) 314
BstYI RGATCY 1 cut(s) 314
BstZ17I GTATAC 1 cut(s) 8
Cac8I GCNNGC 5 cut(s) 67, 71, 75, 208, 325
CfoI GCGC 2 cut(s) 110, 159
Cfr10I RCCGGY 1 cut(s) 254
CspCI CAANNNNNGTGG 2 cut(s) 166, 201
CviAII CATG 2 cut(s) 207, 216
CviJI RGCY 5 cut(s) 73, 150, 254, 341, 357
CviKI_1 RGCY 5 cut(s) 73, 150, 254, 341, 357
DdeI CTNAG 1 cut(s) 153
DpnI GATC 1 cut(s) 316
DpnII GATC 1 cut(s) 314
FaeI CATG 2 cut(s) 210, 219
FaiI YATR 5 cut(s) 8, 59, 208, 217, 379
FatI CATG 2 cut(s) 206, 215
FauI CCCGC 1 cut(s) 70
FblI GTMKAC 1 cut(s) 7
Fnu4HI GCNGC 2 cut(s) 120, 358
Fsp4HI GCNGC 2 cut(s) 120, 358
FspBI CTAG 1 cut(s) 290
GlaI GCGC 2 cut(s) 109, 158
GluI GCNGC 2 cut(s) 120, 358
HapII CCGG 1 cut(s) 255
HhaI GCGC 2 cut(s) 110, 159
Hin1II CATG 2 cut(s) 210, 219
Hin6I GCGC 2 cut(s) 108, 157
HinP1I GCGC 2 cut(s) 108, 157
HinfI GANTC 1 cut(s) 302
HpaII CCGG 1 cut(s) 255
HphI GGTGA 1 cut(s) 308
Hpy166II GTNNAC 1 cut(s) 8
Hpy8I GTNNAC 1 cut(s) 8
HpyAV CCTTC 1 cut(s) 236
HpyCH4III ACNGT 1 cut(s) 20
HpyCH4V TGCA 3 cut(s) 65, 177, 327
HpyF10VI GCNNNNNNNGC 3 cut(s) 116, 156, 366
HpyF3I CTNAG 1 cut(s) 153
Hsp92II CATG 2 cut(s) 210, 219
HspAI GCGC 2 cut(s) 108, 157
Kzo9I GATC 1 cut(s) 314
LmnI GCTCC 1 cut(s) 127
LpnPI CCDG 6 cut(s) 8, 59, 132, 213, 268, 375
Lsp1109I GCAGC 2 cut(s) 106, 344
LweI GCATC 1 cut(s) 124
MaeI CTAG 1 cut(s) 290
MalI GATC 1 cut(s) 316
MboI GATC 1 cut(s) 314
MboII GAAGA 1 cut(s) 211
MflI RGATCY 1 cut(s) 314
MmeI TCCRAC 1 cut(s) 70
MnlI CCTC 1 cut(s) 215
MseI TTAA 2 cut(s) 237, 261
MspI CCGG 1 cut(s) 255
MwoI GCNNNNNNNGC 3 cut(s) 116, 156, 366
NdeII GATC 1 cut(s) 314
NlaIII CATG 2 cut(s) 210, 219
NspI RCATGY 2 cut(s) 210, 219
PaeI GCATGC 1 cut(s) 210
PciI ACATGT 1 cut(s) 215
PfeI GAWTC 1 cut(s) 302
PflMI CCANNNNNTGG 1 cut(s) 22
PkrI GCNGC 2 cut(s) 121, 359
PscI ACATGT 1 cut(s) 215
PsuI RGATCY 1 cut(s) 314
SaqAI TTAA 2 cut(s) 237, 261
SatI GCNGC 2 cut(s) 120, 358
Sau3AI GATC 1 cut(s) 314
SetI ASST 6 cut(s) 75, 132, 247, 343, 349, 359
SfaNI GCATC 1 cut(s) 124
SphI GCATGC 1 cut(s) 210
SsiI CCGC 1 cut(s) 77
SspMI CTAG 1 cut(s) 290
TaaI ACNGT 1 cut(s) 20
TaqI TCGA 2 cut(s) 132, 305
TfiI GAWTC 1 cut(s) 302
Tru1I TTAA 2 cut(s) 237, 261
Tru9I TTAA 2 cut(s) 237, 261
TseI GCWGC 2 cut(s) 119, 357
TspDTI ATGAA 2 cut(s) 130, 315
Van91I CCANNNNNTGG 1 cut(s) 22
XceI RCATGY 2 cut(s) 210, 219
XmiI GTMKAC 1 cut(s) 7
XspI CTAG 1 cut(s) 290
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.