Rroxscaffold_2G00086150

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
8411739 .. 8412680
942 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00086150.1

Sequence Viewer

Length: 333 bp
ATGGACAACATAACTGCAAGCGAGCTGGCGGGTTTTGGAGTTGGAACTCTACTTCTCTGCGCCACCATTGCTGCTCCAAAGGTCGATGCTTTCATCTCTGGCTCTCAGCGCAGTTCTTTGGGAATGTGCAAGAGATGTGGTAATGTGAGGAAGATAGCATGCTCAACGTGTAGAGGAACTGGATTGGTAAAGGAAGGTGGAGTAGCCGGTTTTAATCTCATTGATGACTTGTATCAATCGCTAGGGGGTGATGAATCGAAAGTAAGATCCATTGCTTGCACCAAATGTCAAGCTAAAGGTCATTTTAGCTGCCCTGATTGCTCTAAAACATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

110

Amino Acids

11.37

Weight (kDa)

8.62

Isoelectric Point (pI)

43.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010379)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 29
AclWI GGATC 1 cut(s) 261
AflIII ACRYGT 1 cut(s) 167
AluBI AGCT 3 cut(s) 25, 293, 309
AluI AGCT 3 cut(s) 25, 293, 309
AlwI GGATC 1 cut(s) 261
ApeKI GCWGC 2 cut(s) 71, 309
AspLEI GCGC 2 cut(s) 62, 111
AsuHPI GGTGA 1 cut(s) 260
BbvI GCAGC 2 cut(s) 58, 296
BfaI CTAG 1 cut(s) 242
BisI GCNGC 2 cut(s) 72, 310
BlsI GCNGC 2 cut(s) 73, 311
BmsI GCATC 1 cut(s) 76
Bse118I RCCGGY 1 cut(s) 206
Bse1I ACTGG 1 cut(s) 184
Bse3DI GCAATG 2 cut(s) 66, 270
BseMI GCAATG 2 cut(s) 66, 270
BseMII CTCAG 1 cut(s) 119
BseNI ACTGG 1 cut(s) 184
BseXI GCAGC 2 cut(s) 58, 296
BsiSI CCGG 1 cut(s) 207
Bsp143I GATC 1 cut(s) 266
BspACI CCGC 1 cut(s) 29
BspCNI CTCAG 1 cut(s) 118
BspPI GGATC 1 cut(s) 261
BsrDI GCAATG 2 cut(s) 66, 270
BsrFI RCCGGY 1 cut(s) 206
BsrI ACTGG 1 cut(s) 184
BssAI RCCGGY 1 cut(s) 206
BssMI GATC 1 cut(s) 266
BstC8I GCNNGC 5 cut(s) 19, 23, 27, 160, 277
BstDEI CTNAG 1 cut(s) 105
BstHHI GCGC 2 cut(s) 62, 111
BstKTI GATC 1 cut(s) 269
BstMBI GATC 1 cut(s) 266
BstMWI GCNNNNNNNGC 3 cut(s) 68, 108, 318
BstNSI RCATGY 1 cut(s) 162
BstV1I GCAGC 2 cut(s) 58, 296
BstX2I RGATCY 1 cut(s) 266
BstYI RGATCY 1 cut(s) 266
Cac8I GCNNGC 5 cut(s) 19, 23, 27, 160, 277
CfoI GCGC 2 cut(s) 62, 111
Cfr10I RCCGGY 1 cut(s) 206
CspCI CAANNNNNGTGG 2 cut(s) 118, 153
CviAII CATG 1 cut(s) 159
CviJI RGCY 5 cut(s) 25, 102, 206, 293, 309
CviKI_1 RGCY 5 cut(s) 25, 102, 206, 293, 309
DdeI CTNAG 1 cut(s) 105
DpnI GATC 1 cut(s) 268
DpnII GATC 1 cut(s) 266
FaeI CATG 1 cut(s) 162
FaiI YATR 3 cut(s) 11, 160, 331
FatI CATG 1 cut(s) 158
FauI CCCGC 1 cut(s) 22
Fnu4HI GCNGC 2 cut(s) 72, 310
Fsp4HI GCNGC 2 cut(s) 72, 310
FspBI CTAG 1 cut(s) 242
GlaI GCGC 2 cut(s) 61, 110
GluI GCNGC 2 cut(s) 72, 310
HapII CCGG 1 cut(s) 207
HhaI GCGC 2 cut(s) 62, 111
Hin1II CATG 1 cut(s) 162
Hin6I GCGC 2 cut(s) 60, 109
HinP1I GCGC 2 cut(s) 60, 109
HinfI GANTC 1 cut(s) 254
HpaII CCGG 1 cut(s) 207
HphI GGTGA 1 cut(s) 260
HpyAV CCTTC 1 cut(s) 188
HpyCH4IV ACGT 1 cut(s) 167
HpyCH4V TGCA 3 cut(s) 17, 129, 279
HpyF10VI GCNNNNNNNGC 3 cut(s) 68, 108, 318
HpyF3I CTNAG 1 cut(s) 105
HpySE526I ACGT 1 cut(s) 167
Hsp92II CATG 1 cut(s) 162
HspAI GCGC 2 cut(s) 60, 109
Kzo9I GATC 1 cut(s) 266
LmnI GCTCC 1 cut(s) 79
LpnPI CCDG 5 cut(s) 11, 84, 165, 220, 327
Lsp1109I GCAGC 2 cut(s) 58, 296
LweI GCATC 1 cut(s) 76
MaeI CTAG 1 cut(s) 242
MaeII ACGT 1 cut(s) 167
MalI GATC 1 cut(s) 268
MboI GATC 1 cut(s) 266
MboII GAAGA 1 cut(s) 163
MflI RGATCY 1 cut(s) 266
MmeI TCCRAC 1 cut(s) 22
MnlI CCTC 2 cut(s) 141, 167
MseI TTAA 1 cut(s) 213
MspI CCGG 1 cut(s) 207
MwoI GCNNNNNNNGC 3 cut(s) 68, 108, 318
NdeII GATC 1 cut(s) 266
NlaIII CATG 1 cut(s) 162
NspI RCATGY 1 cut(s) 162
PaeI GCATGC 1 cut(s) 162
PfeI GAWTC 1 cut(s) 254
PkrI GCNGC 2 cut(s) 73, 311
PsuI RGATCY 1 cut(s) 266
SaqAI TTAA 1 cut(s) 213
SatI GCNGC 2 cut(s) 72, 310
Sau3AI GATC 1 cut(s) 266
SetI ASST 7 cut(s) 27, 84, 170, 199, 295, 301, 311
SfaNI GCATC 1 cut(s) 76
SphI GCATGC 1 cut(s) 162
SsiI CCGC 1 cut(s) 29
SspMI CTAG 1 cut(s) 242
TaiI ACGT 1 cut(s) 170
TaqI TCGA 2 cut(s) 84, 257
TfiI GAWTC 1 cut(s) 254
Tru1I TTAA 1 cut(s) 213
Tru9I TTAA 1 cut(s) 213
TseI GCWGC 2 cut(s) 71, 309
TspDTI ATGAA 2 cut(s) 82, 267
XceI RCATGY 1 cut(s) 162
XspI CTAG 1 cut(s) 242
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.