Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr09

Orthogroup ID

OG0015820

Physical Location & Seq

Genomic Coordinates Reverse (-)

25430127 .. 25431409

Gene Structure 1283 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD09G1221300.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 417 bp

ATGGCAAGCCACCAAAATCAGGATTTGAGTCACAAAGCTGGCGAGTTGACTGGGCAAGCTCAGGTTAAGAAGGATGAGTTTCTAAACCAGGCATCGGGTGCAGCTCAGTCTGCCCAAAACCAGGCATCAAATTTATCTCAGTCTGCCCAAAACAAGGCATCAGATGCATCTCAGTCTGCCCAGAACAAGGCATCTGATGCTTCTCATACTGGCCAAGACATCAAGGACCAAGCAACCCACCTCCTTCAACAGACAAGTGAGCAAGTTAGAAACATGGCTCAAGGAGCAGCTGATGCAGTGAAGAACACTTTGGGAATGAATAGCCCTAACGACCCAAGCAACCAAACCAATACCCCAAGCAACCATACCAACCCAAACAACCCAAGCAACCCAAGCAACCCGAGCACTAGGATTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

139

Amino Acids

14.5

Weight (kDa)

6.15

Isoelectric Point (pI)

36.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015820)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G52680
fragaria_vesca	FvH4_6g30370
malus_domestica	MD09G1221300.v1.1 MD17G1204300.v1.1
prunus_persica	Prupe.3G079800_v2.0.a1 Prupe.7G000200_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0136681
rosa_laevigata	RLG00000019560
rosa_multiflora	Rmu_sc0006545.1_g000001
rosa_rugosa	Rorug02G0332300
rosa_samantha	Rh2AG383200 Rh2BG389900 Rh2CG369600 Rh2DG406500
rosa_wichuraiana	Rw2G031320

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	211
AcsI	RAATTY	1 cut(s)	130
AfiI	CCNNNNNNNGG	5 cut(s)	19, 94, 121, 154, 187
AgsI	TTSAA	1 cut(s)	248
AjnI	CCWGG	2 cut(s)	87, 120
AjuI	GAANNNNNNNTTGG	2 cut(s)	293, 325
AluBI	AGCT	4 cut(s)	38, 59, 104, 290
AluI	AGCT	4 cut(s)	38, 59, 104, 290
Alw21I	GWGCWC	1 cut(s)	407
Ama87I	CYCGRG	1 cut(s)	400
AoxI	GGCC	1 cut(s)	211
ApeKI	GCWGC	2 cut(s)	101, 287
ApoI	RAATTY	1 cut(s)	130
AspS9I	GGNCC	1 cut(s)	226
AvaI	CYCGRG	1 cut(s)	400
AvaII	GGWCC	1 cut(s)	226
BalI	TGGCCA	1 cut(s)	213
Bbv12I	GWGCWC	1 cut(s)	407
BbvI	GCAGC	2 cut(s)	113, 299
BciT130I	CCWGG	2 cut(s)	89, 122
BfaI	CTAG	1 cut(s)	408
BisI	GCNGC	2 cut(s)	102, 288
BlsI	GCNGC	2 cut(s)	103, 289
Bme1390I	CCNGG	2 cut(s)	89, 122
Bme18I	GGWCC	1 cut(s)	226
BmeT110I	CYCGRG	1 cut(s)	400
BmgT120I	GGNCC	1 cut(s)	226
BmrFI	CCNGG	2 cut(s)	89, 122
BmrI	ACTGGG	1 cut(s)	60
BmsI	GCATC	8 cut(s)	101, 134, 154, 167, 176, 187, 200, 283
BmuI	ACTGGG	1 cut(s)	60
Bpu10I	CCTNAGC	1 cut(s)	60
BpuEI	CTTGAG	1 cut(s)	264
Bsc4I	CCNNNNNNNGG	5 cut(s)	19, 94, 121, 154, 187
Bse1I	ACTGG	2 cut(s)	55, 214
BseBI	CCWGG	2 cut(s)	89, 122
BseGI	GGATG	1 cut(s)	79
BseLI	CCNNNNNNNGG	5 cut(s)	19, 94, 121, 154, 187
BseMII	CTCAG	4 cut(s)	74, 119, 152, 185
BseNI	ACTGG	2 cut(s)	55, 214
BseXI	GCAGC	2 cut(s)	113, 299
BsgI	GTGCAG	1 cut(s)	120
BshFI	GGCC	1 cut(s)	213
BsiHKAI	GWGCWC	1 cut(s)	407
BsiHKCI	CYCGRG	1 cut(s)	400
BslI	CCNNNNNNNGG	5 cut(s)	19, 94, 121, 154, 187
BsnI	GGCC	1 cut(s)	213
BsoBI	CYCGRG	1 cut(s)	400
Bsp1286I	GDGCHC	1 cut(s)	407
BspANI	GGCC	1 cut(s)	213
BspCNI	CTCAG	4 cut(s)	73, 118, 151, 184
BsrI	ACTGG	2 cut(s)	55, 214
Bst2UI	CCWGG	2 cut(s)	89, 122
BstAPI	GCANNNNNTGC	4 cut(s)	98, 164, 197, 293
BstC8I	GCNNGC	3 cut(s)	7, 40, 57
BstDEI	CTNAG	4 cut(s)	60, 105, 138, 171
BstF5I	GGATG	1 cut(s)	79
BstMWI	GCNNNNNNNGC	8 cut(s)	98, 110, 164, 197, 284, 293, 393, 402
BstNI	CCWGG	2 cut(s)	89, 122
BstSCI	CCNGG	2 cut(s)	87, 120
BstV1I	GCAGC	2 cut(s)	113, 299
BsuRI	GGCC	1 cut(s)	213
BtsCI	GGATG	1 cut(s)	79
BtsI	GCAGTG	1 cut(s)	303
BtsIMutI	CAGTG	1 cut(s)	303
Cac8I	GCNNGC	3 cut(s)	7, 40, 57
Cfr13I	GGNCC	1 cut(s)	226
CviAII	CATG	1 cut(s)	274
CviJI	RGCY	8 cut(s)	9, 38, 59, 104, 213, 278, 290, 324
CviKI_1	RGCY	8 cut(s)	9, 38, 59, 104, 213, 278, 290, 324
DdeI	CTNAG	4 cut(s)	60, 105, 138, 171
EaeI	YGGCCR	1 cut(s)	211
Eco47I	GGWCC	1 cut(s)	226
Eco88I	CYCGRG	1 cut(s)	400
EcoRII	CCWGG	2 cut(s)	87, 120
EcoT22I	ATGCAT	1 cut(s)	169
FaeI	CATG	1 cut(s)	277
FaiI	YATR	3 cut(s)	207, 275, 366
FatI	CATG	1 cut(s)	273
Fnu4HI	GCNGC	2 cut(s)	102, 288
FokI	GGATG	1 cut(s)	86
Fsp4HI	GCNGC	2 cut(s)	102, 288
FspBI	CTAG	1 cut(s)	408
GluI	GCNGC	2 cut(s)	102, 288
HaeIII	GGCC	1 cut(s)	213
Hin1II	CATG	1 cut(s)	277
HincII	GTYRAC	1 cut(s)	48
HindII	GTYRAC	1 cut(s)	48
HinfI	GANTC	1 cut(s)	28
Hpy166II	GTNNAC	1 cut(s)	48
Hpy188I	TCNGA	2 cut(s)	163, 196
Hpy188III	TCNNGA	1 cut(s)	20
Hpy8I	GTNNAC	1 cut(s)	48
HpyAV	CCTTC	2 cut(s)	64, 254
HpyCH4V	TGCA	3 cut(s)	101, 167, 296
HpyF10VI	GCNNNNNNNGC	8 cut(s)	98, 110, 164, 197, 284, 293, 393, 402
HpyF3I	CTNAG	4 cut(s)	60, 105, 138, 171
Hsp92II	CATG	1 cut(s)	277
LmnI	GCTCC	1 cut(s)	284
Lsp1109I	GCAGC	2 cut(s)	113, 299
LweI	GCATC	8 cut(s)	101, 134, 154, 167, 176, 187, 200, 283
MaeI	CTAG	1 cut(s)	408
MaeIII	GTNAC	1 cut(s)	29
MboII	GAAGA	1 cut(s)	313
MhlI	GDGCHC	1 cut(s)	407
MlsI	TGGCCA	1 cut(s)	213
MluCI	AATT	1 cut(s)	130
MluNI	TGGCCA	1 cut(s)	213
MlyI	GAGTC	1 cut(s)	37
MnlI	CCTC	1 cut(s)	251
Mox20I	TGGCCA	1 cut(s)	213
Mph1103I	ATGCAT	1 cut(s)	169
MscI	TGGCCA	1 cut(s)	213
MseI	TTAA	1 cut(s)	66
Msp20I	TGGCCA	1 cut(s)	213
MspA1I	CMGCKG	1 cut(s)	290
MspR9I	CCNGG	2 cut(s)	89, 122
MvaI	CCWGG	2 cut(s)	89, 122
MwoI	GCNNNNNNNGC	8 cut(s)	98, 110, 164, 197, 284, 293, 393, 402
NlaIII	CATG	1 cut(s)	277
NmuCI	GTSAC	1 cut(s)	29
NsiI	ATGCAT	1 cut(s)	169
PkrI	GCNGC	2 cut(s)	103, 289
PleI	GAGTC	1 cut(s)	36
PpsI	GAGTC	1 cut(s)	36
Psp6I	CCWGG	2 cut(s)	87, 120
PspGI	CCWGG	2 cut(s)	87, 120
PspPI	GGNCC	1 cut(s)	226
PvuII	CAGCTG	1 cut(s)	290
SaqAI	TTAA	1 cut(s)	66
SatI	GCNGC	2 cut(s)	102, 288
Sau96I	GGNCC	1 cut(s)	226
SchI	GAGTC	1 cut(s)	37
ScrFI	CCNGG	2 cut(s)	89, 122
SduI	GDGCHC	1 cut(s)	407
SetI	ASST	6 cut(s)	40, 61, 66, 106, 243, 292
SfaNI	GCATC	8 cut(s)	101, 134, 154, 167, 176, 187, 200, 283
SinI	GGWCC	1 cut(s)	226
SmlI	CTYRAG	1 cut(s)	279
SmoI	CTYRAG	1 cut(s)	279
Sse9I	AATT	1 cut(s)	130
SspMI	CTAG	1 cut(s)	408
StyD4I	CCNGG	2 cut(s)	87, 120
TasI	AATT	1 cut(s)	130
Tru1I	TTAA	1 cut(s)	66
Tru9I	TTAA	1 cut(s)	66
TscAI	CASTG	1 cut(s)	303
TseFI	GTSAC	1 cut(s)	29
TseI	GCWGC	2 cut(s)	101, 287
Tsp45I	GTSAC	1 cut(s)	29
TspDTI	ATGAA	1 cut(s)	332
TspRI	CASTG	1 cut(s)	303
VpaK11BI	GGWCC	1 cut(s)	226
XapI	RAATTY	1 cut(s)	130
XspI	CTAG	1 cut(s)	408
Zsp2I	ATGCAT	1 cut(s)	169

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.