MD09G1221400.v1.1

Periodic tryptophan protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Reverse (-)
25480228 .. 25480966
739 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1221400.v1.1.491

Sequence Viewer

Length: 324 bp
ATGGCACTAATTTTTTTAGCTGTTGATGCTGCACGCAATGAAGATAAATTGAGCAAGGCTTTAATCCTTAGTCTCAGATTAAACGAAGACAGTCTAATTAAAAAGTGTATTTTCAAAGTTAATCTGTTAGAAAGTCGCCCACATTTGGAGTTCATACTTCGGTGGTGTCAGGAGCTCTGCAAAGTTCATGGTAACTCTATTCAACAAAACTCTAGAAAGCTGCTTCCTGCTTTAAAATCCCTACAGACGGCAATAACAAGAACACATCAGGATTTGAAAGAGACATGTTCTTCCAATGAATATATGCTTCAATATTTATGTTAA

Protein Analysis

108

Amino Acids

12.36

Weight (kDa)

8.9

Isoelectric Point (pI)

46.04

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Utp12 PF04003 41 - 107 5.9e-16 Dip2/Utp12 Family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011954)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 145, 247
AflIII ACRYGT 1 cut(s) 284
AgsI TTSAA 4 cut(s) 115, 203, 277, 311
AluBI AGCT 3 cut(s) 20, 175, 220
AluI AGCT 3 cut(s) 20, 175, 220
Alw21I GWGCWC 1 cut(s) 177
Alw26I GTCTC 2 cut(s) 77, 275
ApeKI GCWGC 2 cut(s) 29, 220
BanII GRGCYC 1 cut(s) 177
BbsI GAAGAC 1 cut(s) 93
Bbv12I GWGCWC 1 cut(s) 177
BbvI GCAGC 2 cut(s) 16, 207
BceAI ACGGC 1 cut(s) 264
BcoDI GTCTC 2 cut(s) 77, 275
BfaI CTAG 1 cut(s) 213
BfmI CTRYAG 1 cut(s) 242
BisI GCNGC 2 cut(s) 30, 221
BlsI GCNGC 2 cut(s) 31, 222
BmsI GCATC 1 cut(s) 16
BpiI GAAGAC 1 cut(s) 93
Bsc4I CCNNNNNNNGG 2 cut(s) 145, 247
Bse3DI GCAATG 1 cut(s) 43
BseLI CCNNNNNNNGG 2 cut(s) 145, 247
BseMI GCAATG 1 cut(s) 43
BseMII CTCAG 1 cut(s) 88
BseXI GCAGC 2 cut(s) 16, 207
BsgI GTGCAG 1 cut(s) 15
BsiHKAI GWGCWC 1 cut(s) 177
BslI CCNNNNNNNGG 2 cut(s) 145, 247
BsmAI GTCTC 2 cut(s) 77, 275
Bsp1286I GDGCHC 1 cut(s) 177
BspCNI CTCAG 1 cut(s) 87
BsrDI GCAATG 1 cut(s) 43
Bst4CI ACNGT 1 cut(s) 92
BstC8I GCNNGC 1 cut(s) 34
BstDEI CTNAG 2 cut(s) 68, 74
BstMAI GTCTC 2 cut(s) 77, 275
BstMWI GCNNNNNNNGC 1 cut(s) 26
BstNSI RCATGY 1 cut(s) 288
BstSFI CTRYAG 1 cut(s) 242
BstV1I GCAGC 2 cut(s) 16, 207
BstV2I GAAGAC 1 cut(s) 93
Cac8I GCNNGC 1 cut(s) 34
CviAII CATG 2 cut(s) 188, 285
CviJI RGCY 4 cut(s) 20, 59, 175, 220
CviKI_1 RGCY 4 cut(s) 20, 59, 175, 220
DdeI CTNAG 2 cut(s) 68, 74
DraI TTTAAA 1 cut(s) 234
Ecl136II GAGCTC 1 cut(s) 175
Eco24I GRGCYC 1 cut(s) 177
Eco53kI GAGCTC 1 cut(s) 175
EcoICRI GAGCTC 1 cut(s) 175
EcoT38I GRGCYC 1 cut(s) 177
FaeI CATG 2 cut(s) 191, 288
FaiI YATR 6 cut(s) 155, 189, 286, 303, 305, 319
FatI CATG 2 cut(s) 187, 284
Fnu4HI GCNGC 2 cut(s) 30, 221
FriOI GRGCYC 1 cut(s) 177
Fsp4HI GCNGC 2 cut(s) 30, 221
FspBI CTAG 1 cut(s) 213
GluI GCNGC 2 cut(s) 30, 221
Hin1II CATG 2 cut(s) 191, 288
Hpy188I TCNGA 1 cut(s) 77
Hpy188III TCNNGA 3 cut(s) 170, 213, 269
HpyCH4III ACNGT 1 cut(s) 92
HpyCH4V TGCA 2 cut(s) 32, 180
HpyF10VI GCNNNNNNNGC 1 cut(s) 26
HpyF3I CTNAG 2 cut(s) 68, 74
Hsp92II CATG 2 cut(s) 191, 288
LmnI GCTCC 1 cut(s) 172
LpnPI CCDG 3 cut(s) 155, 240, 254
Lsp1109I GCAGC 2 cut(s) 16, 207
LweI GCATC 1 cut(s) 16
MaeI CTAG 1 cut(s) 213
MaeIII GTNAC 1 cut(s) 191
MboII GAAGA 3 cut(s) 53, 98, 282
MhlI GDGCHC 1 cut(s) 177
MluCI AATT 3 cut(s) 9, 47, 96
MseI TTAA 6 cut(s) 62, 80, 99, 120, 233, 322
MwoI GCNNNNNNNGC 1 cut(s) 26
NlaIII CATG 2 cut(s) 191, 288
NspI RCATGY 1 cut(s) 288
PciI ACATGT 1 cut(s) 284
PkrI GCNGC 2 cut(s) 31, 222
PscI ACATGT 1 cut(s) 284
Psp124BI GAGCTC 1 cut(s) 177
SacI GAGCTC 1 cut(s) 177
SaqAI TTAA 6 cut(s) 62, 80, 99, 120, 233, 322
SatI GCNGC 2 cut(s) 30, 221
SduI GDGCHC 1 cut(s) 177
SetI ASST 3 cut(s) 22, 177, 222
SfaNI GCATC 1 cut(s) 16
SfcI CTRYAG 1 cut(s) 242
SgeI CNNG 9 cut(s) 45, 67, 182, 200, 225, 239, 270, 281, 297
Sse9I AATT 3 cut(s) 9, 47, 96
SspI AATATT 1 cut(s) 314
SspMI CTAG 1 cut(s) 213
SstI GAGCTC 1 cut(s) 177
TaaI ACNGT 1 cut(s) 92
TasI AATT 3 cut(s) 9, 47, 96
Tru1I TTAA 6 cut(s) 62, 80, 99, 120, 233, 322
Tru9I TTAA 6 cut(s) 62, 80, 99, 120, 233, 322
TseI GCWGC 2 cut(s) 29, 220
TspDTI ATGAA 4 cut(s) 54, 142, 176, 312
XbaI TCTAGA 1 cut(s) 212
XceI RCATGY 1 cut(s) 288
XspI CTAG 1 cut(s) 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.