MD10G1239200.v1.1

cellular macromolecule catabolic process

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
OG0017169
Physical Location & Seq
Reverse (-)
33533419 .. 33533634
216 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1239200.v1.1.491

Sequence Viewer

Length: 216 bp
ATGGGCATGGTGGTGGTGATCTCTCTGCCTTTTATTTTGTTCACCATACTGCTTGGTTTCGGGTGCTACTTCTTCGGGAGAGCGAGAGGGCGAAAGGACGCGATCGCCACGGCTCAGGTTTACGGGATGCCTGCTCCTCCGCCAGGAGCTACTAACTCTCTCCCTTCCTCTCCTCCACCACATCCTTTCAAGCATGACAACTCTGCCAATGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

7.54

Weight (kDa)

9.62

Isoelectric Point (pI)

49.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017169)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G31335
malus_domestica MD05G1260300.v1.1 MD10G1239200.v1.1
prunus_persica Prupe.4G105200_v2.0.a1
pyrus_communis pycom05g24400 pycom05g24410 pycom10g20020
rosa_chinensis RchiOBHm_Chr5g0018941
rosa_roxburghii Rroxscaffold_1G00058930 Rroxscaffold_1G00073930
rosa_samantha Rh5AG138500 Rh5BG137200
rosa_wichuraiana Rw5G012270

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 101
AciI CCGC 1 cut(s) 140
AfiI CCNNNNNNNGG 1 cut(s) 143
AgsI TTSAA 1 cut(s) 190
AjnI CCWGG 1 cut(s) 142
AluBI AGCT 1 cut(s) 149
AluI AGCT 1 cut(s) 149
AsiSI GCGATCGC 1 cut(s) 105
AsuHPI GGTGA 2 cut(s) 28, 34
BceAI ACGGC 1 cut(s) 126
BciT130I CCWGG 1 cut(s) 144
Bme1390I CCNGG 1 cut(s) 144
BmrFI CCNGG 1 cut(s) 144
BmsI GCATC 1 cut(s) 117
Bpu10I CCTNAGC 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 108
Bsc4I CCNNNNNNNGG 1 cut(s) 143
BseBI CCWGG 1 cut(s) 144
BseDI CCNNGG 1 cut(s) 108
BseGI GGATG 2 cut(s) 132, 181
BseLI CCNNNNNNNGG 1 cut(s) 143
BseMII CTCAG 1 cut(s) 128
BseRI GAGGAG 2 cut(s) 126, 162
Bsh1236I CGCG 1 cut(s) 101
Bsh1285I CGRYCG 1 cut(s) 105
BsiEI CGRYCG 1 cut(s) 105
BslI CCNNNNNNNGG 1 cut(s) 143
Bsp143I GATC 2 cut(s) 18, 102
BspACI CCGC 1 cut(s) 140
BspCNI CTCAG 1 cut(s) 127
BspFNI CGCG 1 cut(s) 101
BssECI CCNNGG 1 cut(s) 108
BssMI GATC 2 cut(s) 18, 102
Bst2UI CCWGG 1 cut(s) 144
BstC8I GCNNGC 1 cut(s) 132
BstDEI CTNAG 1 cut(s) 114
BstDSI CCRYGG 1 cut(s) 108
BstENI CCTNNNNNAGG 1 cut(s) 141
BstF5I GGATG 2 cut(s) 132, 181
BstFNI CGCG 1 cut(s) 101
BstKTI GATC 2 cut(s) 21, 105
BstMBI GATC 2 cut(s) 18, 102
BstMCI CGRYCG 1 cut(s) 105
BstNI CCWGG 1 cut(s) 144
BstSCI CCNGG 1 cut(s) 142
BstUI CGCG 1 cut(s) 101
BtgI CCRYGG 1 cut(s) 108
BtsCI GGATG 2 cut(s) 132, 181
Cac8I GCNNGC 1 cut(s) 132
CseI GACGC 1 cut(s) 107
CviAII CATG 2 cut(s) 7, 194
CviJI RGCY 2 cut(s) 113, 149
CviKI_1 RGCY 2 cut(s) 113, 149
DdeI CTNAG 1 cut(s) 114
DpnI GATC 2 cut(s) 20, 104
DpnII GATC 2 cut(s) 18, 102
EciI GGCGGA 1 cut(s) 129
EcoNI CCTNNNNNAGG 1 cut(s) 141
EcoRII CCWGG 1 cut(s) 142
FaeI CATG 2 cut(s) 10, 197
FaiI YATR 3 cut(s) 8, 47, 195
FatI CATG 2 cut(s) 6, 193
FokI GGATG 2 cut(s) 139, 168
HgaI GACGC 1 cut(s) 107
Hin1II CATG 2 cut(s) 10, 197
HphI GGTGA 2 cut(s) 28, 34
Hpy166II GTNNAC 2 cut(s) 42, 121
Hpy188III TCNNGA 1 cut(s) 76
Hpy8I GTNNAC 2 cut(s) 42, 121
HpyAV CCTTC 1 cut(s) 174
HpyF3I CTNAG 1 cut(s) 114
Hsp92II CATG 2 cut(s) 10, 197
Kzo9I GATC 2 cut(s) 18, 102
LmnI GCTCC 2 cut(s) 139, 146
LpnPI CCDG 4 cut(s) 101, 129, 144, 156
LweI GCATC 1 cut(s) 117
MalI GATC 2 cut(s) 20, 104
MboI GATC 2 cut(s) 18, 102
MboII GAAGA 1 cut(s) 64
MnlI CCTC 4 cut(s) 80, 147, 178, 183
MseI TTAA 1 cut(s) 214
MslI CAYNNNNRTG 1 cut(s) 11
MspR9I CCNGG 1 cut(s) 144
MvaI CCWGG 1 cut(s) 144
MvnI CGCG 1 cut(s) 101
NdeII GATC 2 cut(s) 18, 102
NlaIII CATG 2 cut(s) 10, 197
Ple19I CGATCG 1 cut(s) 105
Psp6I CCWGG 1 cut(s) 142
PspGI CCWGG 1 cut(s) 142
PvuI CGATCG 1 cut(s) 105
RgaI GCGATCGC 1 cut(s) 105
RseI CAYNNNNRTG 1 cut(s) 11
SaqAI TTAA 1 cut(s) 214
Sau3AI GATC 2 cut(s) 18, 102
ScrFI CCNGG 1 cut(s) 144
SetI ASST 2 cut(s) 120, 151
SfaAI GCGATCGC 1 cut(s) 105
SfaNI GCATC 1 cut(s) 117
SgfI GCGATCGC 1 cut(s) 105
SmiMI CAYNNNNRTG 1 cut(s) 11
SsiI CCGC 1 cut(s) 140
StyD4I CCNGG 1 cut(s) 142
Tru1I TTAA 1 cut(s) 214
Tru9I TTAA 1 cut(s) 214
XagI CCTNNNNNAGG 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.