Prupe.4G105200_v2.0.a1

cellular macromolecule catabolic process

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
5436444 .. 5437078
635 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G105200.1

Sequence Viewer

Length: 216 bp
ATGGGTATGGTTGTGGTGATCTCTCTGCCTTTTATTTTGTTCACCATACTGCTTGGTTTTGGGTGCTACTTCTTTGGAAGAGCCAGAGGGCGAAAAGACGCAATTGCCTCAGCTCAGGTTTATGGGGTGCCTACTCCACCACCAGGAGCTAATAATTCTCTGCCTTCATCTCCTCCACCAAATCCTTTCAAGCACGACAACTCTGCCAATGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

7.52

Weight (kDa)

9.62

Isoelectric Point (pI)

43.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017169)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 127
AfiI CCNNNNNNNGG 1 cut(s) 143
AgsI TTSAA 1 cut(s) 190
AjnI CCWGG 1 cut(s) 142
AluBI AGCT 2 cut(s) 113, 149
AluI AGCT 2 cut(s) 113, 149
AsuHPI GGTGA 2 cut(s) 28, 34
BanI GGYRCC 1 cut(s) 127
BbvCI CCTCAGC 1 cut(s) 109
BcgI CGANNNNNNTGC 1 cut(s) 185
BciT130I CCWGG 1 cut(s) 144
Bme1390I CCNGG 1 cut(s) 144
BmiI GGNNCC 1 cut(s) 129
BmrFI CCNGG 1 cut(s) 144
Bpu10I CCTNAGC 2 cut(s) 109, 114
Bsc4I CCNNNNNNNGG 1 cut(s) 143
BseBI CCWGG 1 cut(s) 144
BseLI CCNNNNNNNGG 1 cut(s) 143
BseMII CTCAG 2 cut(s) 123, 128
BseRI GAGGAG 1 cut(s) 162
BshNI GGYRCC 1 cut(s) 127
BslI CCNNNNNNNGG 1 cut(s) 143
Bsp143I GATC 1 cut(s) 18
BspCNI CTCAG 2 cut(s) 122, 127
BspLI GGNNCC 1 cut(s) 129
BspQI GCTCTTC 1 cut(s) 73
BspT107I GGYRCC 1 cut(s) 127
BssMI GATC 1 cut(s) 18
Bst2UI CCWGG 1 cut(s) 144
Bst6I CTCTTC 1 cut(s) 73
BstDEI CTNAG 2 cut(s) 109, 114
BstKTI GATC 1 cut(s) 21
BstMBI GATC 1 cut(s) 18
BstNI CCWGG 1 cut(s) 144
BstSCI CCNGG 1 cut(s) 142
CseI GACGC 1 cut(s) 107
CviJI RGCY 3 cut(s) 83, 113, 149
CviKI_1 RGCY 3 cut(s) 83, 113, 149
DdeI CTNAG 2 cut(s) 109, 114
DpnI GATC 1 cut(s) 20
DpnII GATC 1 cut(s) 18
Eam1104I CTCTTC 1 cut(s) 73
EarI CTCTTC 1 cut(s) 73
EcoRII CCWGG 1 cut(s) 142
FaiI YATR 3 cut(s) 8, 47, 123
HgaI GACGC 1 cut(s) 107
HphI GGTGA 2 cut(s) 28, 34
Hpy166II GTNNAC 1 cut(s) 42
Hpy8I GTNNAC 1 cut(s) 42
HpyAV CCTTC 1 cut(s) 174
HpyF3I CTNAG 2 cut(s) 109, 114
Kzo9I GATC 1 cut(s) 18
LguI GCTCTTC 1 cut(s) 73
LmnI GCTCC 1 cut(s) 146
LpnPI CCDG 4 cut(s) 97, 101, 129, 156
MalI GATC 1 cut(s) 20
MboI GATC 1 cut(s) 18
MboII GAAGA 1 cut(s) 90
MfeI CAATTG 1 cut(s) 102
MluCI AATT 2 cut(s) 102, 154
MnlI CCTC 3 cut(s) 80, 118, 183
MspR9I CCNGG 1 cut(s) 144
MunI CAATTG 1 cut(s) 102
MvaI CCWGG 1 cut(s) 144
NdeII GATC 1 cut(s) 18
NlaIV GGNNCC 1 cut(s) 129
PciSI GCTCTTC 1 cut(s) 73
Psp6I CCWGG 1 cut(s) 142
PspGI CCWGG 1 cut(s) 142
PspN4I GGNNCC 1 cut(s) 129
SapI GCTCTTC 1 cut(s) 73
Sau3AI GATC 1 cut(s) 18
ScrFI CCNGG 1 cut(s) 144
SetI ASST 3 cut(s) 115, 120, 151
SgeI CNNG 7 cut(s) 65, 96, 128, 155, 156, 202, 206
Sse9I AATT 2 cut(s) 102, 154
StyD4I CCNGG 1 cut(s) 142
TasI AATT 2 cut(s) 102, 154
TspDTI ATGAA 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.