pycom05g24400

cellular macromolecule catabolic process

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
Physical Location & Seq
Reverse (-)
25985721 .. 25985930
210 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g24400.1

Sequence Viewer

Length: 210 bp
ATGGTGGTGGTGATCTCTCTGCCTTTTATTTTGTTCACCATACTGCTGGGTTTCGGGTGCTACTTCTTCGGGAGGGCGAGAGGGCGAAAGGACGCGATTGCCACGGCTCAGGTTTACGGGGTGCCTGCTCCTCCACCAGGAGCTAATAACTCCCTCCCTTCATCTCCTCCACCTCATCTCTTCAAACACGACAACTCTGCCAATGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.35

Weight (kDa)

9.62

Isoelectric Point (pI)

47.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017169)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 121
AccII CGCG 1 cut(s) 95
AfiI CCNNNNNNNGG 1 cut(s) 137
AgsI TTSAA 1 cut(s) 184
AjnI CCWGG 1 cut(s) 136
AluBI AGCT 1 cut(s) 143
AluI AGCT 1 cut(s) 143
AsuHPI GGTGA 2 cut(s) 22, 28
BanI GGYRCC 1 cut(s) 121
BceAI ACGGC 1 cut(s) 120
BcgI CGANNNNNNTGC 1 cut(s) 179
BciT130I CCWGG 1 cut(s) 138
Bme1390I CCNGG 1 cut(s) 138
BmiI GGNNCC 1 cut(s) 123
BmrFI CCNGG 1 cut(s) 138
Bpu10I CCTNAGC 1 cut(s) 108
BsaJI CCNNGG 1 cut(s) 102
Bsc4I CCNNNNNNNGG 1 cut(s) 137
BseBI CCWGG 1 cut(s) 138
BseDI CCNNGG 1 cut(s) 102
BseLI CCNNNNNNNGG 1 cut(s) 137
BseMII CTCAG 1 cut(s) 122
BseRI GAGGAG 2 cut(s) 120, 156
BseYI CCCAGC 1 cut(s) 46
Bsh1236I CGCG 1 cut(s) 95
BshNI GGYRCC 1 cut(s) 121
BslI CCNNNNNNNGG 1 cut(s) 137
Bsp143I GATC 1 cut(s) 12
BspCNI CTCAG 1 cut(s) 121
BspFNI CGCG 1 cut(s) 95
BspLI GGNNCC 1 cut(s) 123
BspT107I GGYRCC 1 cut(s) 121
BssECI CCNNGG 1 cut(s) 102
BssMI GATC 1 cut(s) 12
Bst2UI CCWGG 1 cut(s) 138
Bst6I CTCTTC 1 cut(s) 185
BstC8I GCNNGC 1 cut(s) 126
BstDEI CTNAG 1 cut(s) 108
BstDSI CCRYGG 1 cut(s) 102
BstENI CCTNNNNNAGG 1 cut(s) 135
BstFNI CGCG 1 cut(s) 95
BstKTI GATC 1 cut(s) 15
BstMBI GATC 1 cut(s) 12
BstNI CCWGG 1 cut(s) 138
BstSCI CCNGG 1 cut(s) 136
BstUI CGCG 1 cut(s) 95
BstXI CCANNNNNNTGG 1 cut(s) 46
BtgI CCRYGG 1 cut(s) 102
Cac8I GCNNGC 1 cut(s) 126
CseI GACGC 1 cut(s) 101
CviJI RGCY 2 cut(s) 107, 143
CviKI_1 RGCY 2 cut(s) 107, 143
DdeI CTNAG 1 cut(s) 108
DpnI GATC 1 cut(s) 14
DpnII GATC 1 cut(s) 12
Eam1104I CTCTTC 1 cut(s) 185
EarI CTCTTC 1 cut(s) 185
EcoNI CCTNNNNNAGG 1 cut(s) 135
EcoRII CCWGG 1 cut(s) 136
FaiI YATR 1 cut(s) 41
GsaI CCCAGC 1 cut(s) 50
HgaI GACGC 1 cut(s) 101
HphI GGTGA 2 cut(s) 22, 28
Hpy166II GTNNAC 2 cut(s) 36, 115
Hpy188III TCNNGA 1 cut(s) 70
Hpy8I GTNNAC 2 cut(s) 36, 115
HpyAV CCTTC 1 cut(s) 168
HpyF3I CTNAG 1 cut(s) 108
Kzo9I GATC 1 cut(s) 12
LmnI GCTCC 2 cut(s) 133, 140
LpnPI CCDG 5 cut(s) 32, 95, 123, 138, 150
MalI GATC 1 cut(s) 14
MboI GATC 1 cut(s) 12
MboII GAAGA 2 cut(s) 58, 172
MnlI CCTC 6 cut(s) 66, 74, 141, 164, 177, 183
MspR9I CCNGG 1 cut(s) 138
MvaI CCWGG 1 cut(s) 138
MvnI CGCG 1 cut(s) 95
NdeII GATC 1 cut(s) 12
NlaIV GGNNCC 1 cut(s) 123
Psp6I CCWGG 1 cut(s) 136
PspFI CCCAGC 1 cut(s) 46
PspGI CCWGG 1 cut(s) 136
PspN4I GGNNCC 1 cut(s) 123
Sau3AI GATC 1 cut(s) 12
ScrFI CCNGG 1 cut(s) 138
SetI ASST 3 cut(s) 114, 145, 175
StyD4I CCNGG 1 cut(s) 136
TspDTI ATGAA 1 cut(s) 150
XagI CCTNNNNNAGG 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.